Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000171.1

Orthogroup ID

OG0005261

Physical Location & Seq

Genomic Coordinates Forward (+)

75779 .. 76090

Gene Structure 312 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000171.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 312 bp

atgatcaggatcagcaagaaccatgcccccccctcagttgctgatccaccacatgctaacatttctagaagtgatagcagagaggtgttgcatacctatgactatagacaagatcctctggaaattcttgagggtgtgagaattaataatacacttgaatcttcaatatcaaccatcaatggtgtttttaaggactcaaaagaagagcagttgagctttgataaagaggagctgaggagagcggaagaacgaccaagggtggcatttattgaattttaccataagcttcaacttctaaagcactacaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005802 GO:0005886 GO:0012505 GO:0016020 GO:0031984 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0071944 GO:0098791

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EXS SPX

Protein Analysis

103

Amino Acids

12.12

Weight (kDa)

6.51

Isoelectric Point (pI)

75.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005261)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G69480 AT1G69480
fragaria_vesca	FvH4_4g30940 FvH4_4g30940 FvH4_4g30940
malus_domestica	MD00G1081200.v1.1 MD00G1081400.v1.1
prunus_persica	Prupe.1G278600_v2.0.a1 Prupe.1G278600_v2.0.a1 Prupe.1G278600_v2.0.a1 Prupe.1G278600_v2.0.a1 Prupe.1G278600_v2.0.a1
pyrus_communis	pycom13g06130
rosa_chinensis	RchiOBHm_Chr4g0439241 RchiOBHm_Chr4g0439281
rosa_laevigata	RLG00000006285
rosa_multiflora	Rmu_sc0006598.1_g000011 Rmu_ssc0000171.1_g000023 Rmu_ssc0000171.1_g000024
rosa_roxburghii	Rroxscaffold_5G00380240
rosa_rugosa	Rorug04G0317200
rosa_samantha	Rh4AG367800 Rh4AG367900 Rh4BG379700 Rh4CG394000 Rh4DG374200
rosa_wichuraiana	Rw0G005610 Rw0G011620 Rw5G028560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	242
AciI	CCGC	1 cut(s)	242
AclWI	GGATC	3 cut(s)	17, 38, 107
AcsI	RAATTY	2 cut(s)	123, 272
AgsI	TTSAA	4 cut(s)	158, 165, 272, 290
AluBI	AGCT	3 cut(s)	216, 232, 286
AluI	AGCT	3 cut(s)	216, 232, 286
AlwI	GGATC	3 cut(s)	17, 38, 107
AlwNI	CAGNNNCTG	1 cut(s)	41
ApoI	RAATTY	2 cut(s)	123, 272
AseI	ATTAAT	1 cut(s)	144
BbvCI	CCTCAGC	1 cut(s)	233
BccI	CCATC	1 cut(s)	182
BclI	TGATCA	1 cut(s)	3
BfaI	CTAG	1 cut(s)	66
BfmI	CTRYAG	2 cut(s)	103, 304
Bpu10I	CCTNAGC	1 cut(s)	233
BpuEI	CTTGAG	1 cut(s)	149
BsaBI	GATNNNNATC	1 cut(s)	8
BsaJI	CCNNGG	1 cut(s)	254
Bse8I	GATNNNNATC	1 cut(s)	8
BseDI	CCNNGG	1 cut(s)	254
BseJI	GATNNNNATC	1 cut(s)	8
BseMII	CTCAG	2 cut(s)	48, 224
BseRI	GAGGAG	2 cut(s)	242, 250
Bsp143I	GATC	4 cut(s)	3, 9, 43, 112
BspACI	CCGC	1 cut(s)	242
BspCNI	CTCAG	2 cut(s)	47, 225
BspPI	GGATC	3 cut(s)	17, 38, 107
BspQI	GCTCTTC	1 cut(s)	198
BsrBI	CCGCTC	1 cut(s)	242
BssECI	CCNNGG	1 cut(s)	254
BssMI	GATC	4 cut(s)	3, 9, 43, 112
BssT1I	CCWWGG	1 cut(s)	254
Bst6I	CTCTTC	1 cut(s)	198
BstDEI	CTNAG	2 cut(s)	34, 233
BstKTI	GATC	4 cut(s)	6, 12, 46, 115
BstMBI	GATC	4 cut(s)	3, 9, 43, 112
BstNSI	RCATGY	1 cut(s)	56
BstSFI	CTRYAG	2 cut(s)	103, 304
BstX2I	RGATCY	1 cut(s)	112
BstYI	RGATCY	1 cut(s)	112
CaiI	CAGNNNCTG	1 cut(s)	41
CviAII	CATG	2 cut(s)	23, 53
CviJI	RGCY	3 cut(s)	216, 232, 286
CviKI_1	RGCY	3 cut(s)	216, 232, 286
DdeI	CTNAG	2 cut(s)	34, 233
DpnI	GATC	4 cut(s)	5, 11, 45, 114
DpnII	GATC	4 cut(s)	3, 9, 43, 112
Eam1104I	CTCTTC	1 cut(s)	198
EarI	CTCTTC	1 cut(s)	198
Eco130I	CCWWGG	1 cut(s)	254
EcoT14I	CCWWGG	1 cut(s)	254
ErhI	CCWWGG	1 cut(s)	254
FaeI	CATG	2 cut(s)	26, 56
FaiI	YATR	6 cut(s)	24, 54, 93, 99, 105, 282
FatI	CATG	2 cut(s)	22, 52
FbaI	TGATCA	1 cut(s)	3
FspBI	CTAG	1 cut(s)	66
Hin1II	CATG	2 cut(s)	26, 56
HindIII	AAGCTT	1 cut(s)	284
HinfI	GANTC	2 cut(s)	158, 194
Hpy188III	TCNNGA	4 cut(s)	7, 66, 119, 128
HpyCH4V	TGCA	1 cut(s)	91
HpyF3I	CTNAG	2 cut(s)	34, 233
Hsp92II	CATG	2 cut(s)	26, 56
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	4 cut(s)	3, 9, 43, 112
LguI	GCTCTTC	1 cut(s)	198
LmnI	GCTCC	1 cut(s)	229
LpnPI	CCDG	2 cut(s)	104, 292
MaeI	CTAG	1 cut(s)	66
MalI	GATC	4 cut(s)	5, 11, 45, 114
MbiI	CCGCTC	1 cut(s)	242
MboI	GATC	4 cut(s)	3, 9, 43, 112
MboII	GAAGA	3 cut(s)	153, 215, 257
MflI	RGATCY	1 cut(s)	112
MluCI	AATT	3 cut(s)	123, 141, 272
MlyI	GAGTC	1 cut(s)	188
MnlI	CCTC	6 cut(s)	43, 76, 124, 126, 220, 228
MseI	TTAA	2 cut(s)	144, 189
MslI	CAYNNNNRTG	1 cut(s)	96
NdeII	GATC	4 cut(s)	3, 9, 43, 112
NlaIII	CATG	2 cut(s)	26, 56
NspI	RCATGY	1 cut(s)	56
PciSI	GCTCTTC	1 cut(s)	198
PfeI	GAWTC	1 cut(s)	158
PleI	GAGTC	1 cut(s)	188
PpsI	GAGTC	1 cut(s)	188
PshBI	ATTAAT	1 cut(s)	144
PstNI	CAGNNNCTG	1 cut(s)	41
PsuI	RGATCY	1 cut(s)	112
RseI	CAYNNNNRTG	1 cut(s)	96
SapI	GCTCTTC	1 cut(s)	198
SaqAI	TTAA	2 cut(s)	144, 189
Sau3AI	GATC	4 cut(s)	3, 9, 43, 112
SchI	GAGTC	1 cut(s)	188
SetI	ASST	6 cut(s)	87, 98, 218, 234, 288, 311
SfcI	CTRYAG	2 cut(s)	103, 304
SmiMI	CAYNNNNRTG	1 cut(s)	96
SmlI	CTYRAG	1 cut(s)	128
SmoI	CTYRAG	1 cut(s)	128
Sse9I	AATT	3 cut(s)	123, 141, 272
SsiI	CCGC	1 cut(s)	242
SspMI	CTAG	1 cut(s)	66
StyI	CCWWGG	1 cut(s)	254
TasI	AATT	3 cut(s)	123, 141, 272
TfiI	GAWTC	1 cut(s)	158
Tru1I	TTAA	2 cut(s)	144, 189
Tru9I	TTAA	2 cut(s)	144, 189
VspI	ATTAAT	1 cut(s)	144
XapI	RAATTY	2 cut(s)	123, 272
XbaI	TCTAGA	1 cut(s)	65
XceI	RCATGY	1 cut(s)	56
XspI	CTAG	1 cut(s)	66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.