Rroxscaffold_1G00035610

Signal recognition particle 54 kDa protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
51718876 .. 51722541
3666 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00035610.1

Sequence Viewer

Length: 258 bp
ATGGATACTGCTGGAAGGCTTCAAATAGACAAAGTACTGATGGATGAGTTGAAAGAAGTAAAGCGGGAAATGAACCCCATAGAAAATTTACTCGTTGTGGTTGCAATGACTGGCCAGGAAGATGCAGCCCTGGTCACAACATTCAATGTAGAGATTGGGATTACTGGCGCTATTTTAACAAAGCTGGATGGAGATTCTAGAGGTGTAAAGCAAGGACAGCAGCTGCAGTCAAAGTTCCAGAGTTTCAATTTGAGGTGA

Protein Analysis

85

Amino Acids

9.41

Weight (kDa)

4.99

Isoelectric Point (pI)

46.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP54 PF00448 1 - 68 4e-21 SRP54-type protein, GTPase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 64
AcoI YGGCCR 1 cut(s) 112
AcsI RAATTY 1 cut(s) 85
AfaI GTAC 1 cut(s) 36
AgsI TTSAA 4 cut(s) 23, 52, 145, 247
AjnI CCWGG 2 cut(s) 114, 129
AluBI AGCT 2 cut(s) 184, 223
AluI AGCT 2 cut(s) 184, 223
AlwNI CAGNNNCTG 1 cut(s) 223
AoxI GGCC 1 cut(s) 112
ApeKI GCWGC 3 cut(s) 125, 220, 223
ApoI RAATTY 1 cut(s) 85
AspLEI GCGC 1 cut(s) 170
BalI TGGCCA 1 cut(s) 114
BbvI GCAGC 3 cut(s) 137, 210, 232
BccI CCATC 2 cut(s) 34, 182
BciT130I CCWGG 2 cut(s) 116, 131
BfaI CTAG 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 224
BfoI RGCGCY 1 cut(s) 171
BisI GCNGC 3 cut(s) 126, 221, 224
BlsI GCNGC 3 cut(s) 127, 222, 225
BmcAI AGTACT 1 cut(s) 36
Bme1390I CCNGG 2 cut(s) 116, 131
BmrFI CCNGG 2 cut(s) 116, 131
BmsI GCATC 1 cut(s) 112
BsaJI CCNNGG 1 cut(s) 129
Bse1I ACTGG 2 cut(s) 115, 169
Bse3DI GCAATG 1 cut(s) 111
BseBI CCWGG 2 cut(s) 116, 131
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 2 cut(s) 49, 193
BseMI GCAATG 1 cut(s) 111
BseNI ACTGG 2 cut(s) 115, 169
BseXI GCAGC 3 cut(s) 137, 210, 232
BshFI GGCC 1 cut(s) 114
BsnI GGCC 1 cut(s) 114
BspACI CCGC 1 cut(s) 64
BspANI GGCC 1 cut(s) 114
BspMAI CTGCAG 1 cut(s) 228
BsrDI GCAATG 1 cut(s) 111
BsrI ACTGG 2 cut(s) 115, 169
BssECI CCNNGG 1 cut(s) 129
Bst2UI CCWGG 2 cut(s) 116, 131
BstF5I GGATG 2 cut(s) 49, 193
BstH2I RGCGCY 1 cut(s) 171
BstHHI GCGC 1 cut(s) 170
BstMWI GCNNNNNNNGC 1 cut(s) 217
BstNI CCWGG 2 cut(s) 116, 131
BstSCI CCNGG 2 cut(s) 114, 129
BstSFI CTRYAG 1 cut(s) 224
BstV1I GCAGC 3 cut(s) 137, 210, 232
BsuRI GGCC 1 cut(s) 114
BtsCI GGATG 2 cut(s) 49, 193
CaiI CAGNNNCTG 1 cut(s) 223
CfoI GCGC 1 cut(s) 170
Csp6I GTAC 1 cut(s) 35
CviJI RGCY 5 cut(s) 19, 114, 128, 184, 223
CviKI_1 RGCY 5 cut(s) 19, 114, 128, 184, 223
CviQI GTAC 1 cut(s) 35
EaeI YGGCCR 1 cut(s) 112
EcoRII CCWGG 2 cut(s) 114, 129
FaiI YATR 1 cut(s) 80
FauI CCCGC 1 cut(s) 57
Fnu4HI GCNGC 3 cut(s) 126, 221, 224
FokI GGATG 2 cut(s) 56, 200
Fsp4HI GCNGC 3 cut(s) 126, 221, 224
FspBI CTAG 1 cut(s) 198
GlaI GCGC 1 cut(s) 169
GluI GCNGC 3 cut(s) 126, 221, 224
HaeII RGCGCY 1 cut(s) 171
HaeIII GGCC 1 cut(s) 114
HhaI GCGC 1 cut(s) 170
Hin6I GCGC 1 cut(s) 168
HinP1I GCGC 1 cut(s) 168
HinfI GANTC 1 cut(s) 194
Hpy188III TCNNGA 2 cut(s) 198, 238
HpyAV CCTTC 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 104, 125, 226
HpyF10VI GCNNNNNNNGC 1 cut(s) 217
HspAI GCGC 1 cut(s) 168
LpnPI CCDG 8 cut(s) 96, 101, 116, 128, 143, 150, 170, 251
Lsp1109I GCAGC 3 cut(s) 137, 210, 232
LweI GCATC 1 cut(s) 112
MaeI CTAG 1 cut(s) 198
MaeIII GTNAC 1 cut(s) 133
MboII GAAGA 1 cut(s) 131
MlsI TGGCCA 1 cut(s) 114
MluCI AATT 2 cut(s) 85, 247
MluNI TGGCCA 1 cut(s) 114
MnlI CCTC 2 cut(s) 194, 246
Mox20I TGGCCA 1 cut(s) 114
MscI TGGCCA 1 cut(s) 114
MseI TTAA 1 cut(s) 176
Msp20I TGGCCA 1 cut(s) 114
MspA1I CMGCKG 1 cut(s) 223
MspR9I CCNGG 2 cut(s) 116, 131
MvaI CCWGG 2 cut(s) 116, 131
MwoI GCNNNNNNNGC 1 cut(s) 217
NmuCI GTSAC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 194
PkrI GCNGC 3 cut(s) 127, 222, 225
Psp6I CCWGG 2 cut(s) 114, 129
PspGI CCWGG 2 cut(s) 114, 129
PstI CTGCAG 1 cut(s) 228
PstNI CAGNNNCTG 1 cut(s) 223
PvuII CAGCTG 1 cut(s) 223
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
SaqAI TTAA 1 cut(s) 176
SatI GCNGC 3 cut(s) 126, 221, 224
ScaI AGTACT 1 cut(s) 36
ScrFI CCNGG 2 cut(s) 116, 131
SetI ASST 4 cut(s) 186, 205, 225, 257
SfaNI GCATC 1 cut(s) 112
SfcI CTRYAG 1 cut(s) 224
Sse9I AATT 2 cut(s) 85, 247
SsiI CCGC 1 cut(s) 64
SspMI CTAG 1 cut(s) 198
StyD4I CCNGG 2 cut(s) 114, 129
TasI AATT 2 cut(s) 85, 247
TatI WGTACW 1 cut(s) 34
TfiI GAWTC 1 cut(s) 194
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TseFI GTSAC 1 cut(s) 133
TseI GCWGC 3 cut(s) 125, 220, 223
Tsp45I GTSAC 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 86
XapI RAATTY 1 cut(s) 85
XbaI TCTAGA 1 cut(s) 197
XspI CTAG 1 cut(s) 198
ZrmI AGTACT 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.