Rroxscaffold_3G00241820

Signal recognition particle 54 kDa protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
34046480 .. 34050102
3623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00241820.1

Sequence Viewer

Length: 195 bp
ATGGATGAGTTGAAAGAAGTAAAGCGGGAAATGAACCCCACAGAAACTTTACTCGTTGTGGATGCAATGACTGGCCAGGAAGCTGCAGCCCTGGTCACAACATTCAATGTAGAGATTGGGATTACTGGCGCTATTTTAACAAAGCTGGATGGAGATTCTAGAGGTGGAGCAGCTTTGAGTGTTAAAGAGGTGTAA

Protein Analysis

64

Amino Acids

6.75

Weight (kDa)

4.41

Isoelectric Point (pI)

20.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP54 PF00448 1 - 63 1.7e-20 SRP54-type protein, GTPase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 25
AcoI YGGCCR 1 cut(s) 73
AgsI TTSAA 2 cut(s) 13, 106
AjnI CCWGG 2 cut(s) 75, 90
AluBI AGCT 3 cut(s) 83, 145, 173
AluI AGCT 3 cut(s) 83, 145, 173
AoxI GGCC 1 cut(s) 73
ApeKI GCWGC 3 cut(s) 83, 86, 170
AspLEI GCGC 1 cut(s) 131
BalI TGGCCA 1 cut(s) 75
BbvI GCAGC 3 cut(s) 70, 98, 182
BccI CCATC 1 cut(s) 143
BciT130I CCWGG 2 cut(s) 77, 92
BfaI CTAG 1 cut(s) 159
BfmI CTRYAG 1 cut(s) 84
BfoI RGCGCY 1 cut(s) 132
BisI GCNGC 3 cut(s) 84, 87, 171
BlsI GCNGC 3 cut(s) 85, 88, 172
Bme1390I CCNGG 2 cut(s) 77, 92
BmrFI CCNGG 2 cut(s) 77, 92
BmsI GCATC 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 90
Bse1I ACTGG 2 cut(s) 76, 130
Bse3DI GCAATG 1 cut(s) 72
BseBI CCWGG 2 cut(s) 77, 92
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 3 cut(s) 10, 67, 154
BseMI GCAATG 1 cut(s) 72
BseNI ACTGG 2 cut(s) 76, 130
BseXI GCAGC 3 cut(s) 70, 98, 182
BshFI GGCC 1 cut(s) 75
BsnI GGCC 1 cut(s) 75
BspACI CCGC 1 cut(s) 25
BspANI GGCC 1 cut(s) 75
BspMAI CTGCAG 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 72
BsrI ACTGG 2 cut(s) 76, 130
BssECI CCNNGG 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 77, 92
BstF5I GGATG 3 cut(s) 10, 67, 154
BstH2I RGCGCY 1 cut(s) 132
BstHHI GCGC 1 cut(s) 131
BstNI CCWGG 2 cut(s) 77, 92
BstSCI CCNGG 2 cut(s) 75, 90
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 3 cut(s) 70, 98, 182
BsuRI GGCC 1 cut(s) 75
BtsCI GGATG 3 cut(s) 10, 67, 154
CfoI GCGC 1 cut(s) 131
CviJI RGCY 5 cut(s) 75, 83, 89, 145, 173
CviKI_1 RGCY 5 cut(s) 75, 83, 89, 145, 173
EaeI YGGCCR 1 cut(s) 73
EcoRII CCWGG 2 cut(s) 75, 90
FauI CCCGC 1 cut(s) 18
Fnu4HI GCNGC 3 cut(s) 84, 87, 171
FokI GGATG 3 cut(s) 17, 74, 161
Fsp4HI GCNGC 3 cut(s) 84, 87, 171
FspBI CTAG 1 cut(s) 159
GlaI GCGC 1 cut(s) 130
GluI GCNGC 3 cut(s) 84, 87, 171
HaeII RGCGCY 1 cut(s) 132
HaeIII GGCC 1 cut(s) 75
HhaI GCGC 1 cut(s) 131
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HinfI GANTC 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 159
HpyCH4V TGCA 2 cut(s) 65, 86
HspAI GCGC 1 cut(s) 129
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 7 cut(s) 57, 62, 77, 89, 104, 111, 131
Lsp1109I GCAGC 3 cut(s) 70, 98, 182
LweI GCATC 1 cut(s) 52
MaeI CTAG 1 cut(s) 159
MaeIII GTNAC 1 cut(s) 94
MlsI TGGCCA 1 cut(s) 75
MluNI TGGCCA 1 cut(s) 75
MnlI CCTC 2 cut(s) 155, 181
Mox20I TGGCCA 1 cut(s) 75
MscI TGGCCA 1 cut(s) 75
MseI TTAA 2 cut(s) 137, 183
Msp20I TGGCCA 1 cut(s) 75
MspR9I CCNGG 2 cut(s) 77, 92
MvaI CCWGG 2 cut(s) 77, 92
NmuCI GTSAC 1 cut(s) 94
PfeI GAWTC 1 cut(s) 155
PkrI GCNGC 3 cut(s) 85, 88, 172
Psp6I CCWGG 2 cut(s) 75, 90
PspGI CCWGG 2 cut(s) 75, 90
PstI CTGCAG 1 cut(s) 88
SaqAI TTAA 2 cut(s) 137, 183
SatI GCNGC 3 cut(s) 84, 87, 171
ScrFI CCNGG 2 cut(s) 77, 92
SetI ASST 5 cut(s) 85, 147, 166, 175, 192
SfaNI GCATC 1 cut(s) 52
SfcI CTRYAG 1 cut(s) 84
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 159
StyD4I CCNGG 2 cut(s) 75, 90
TfiI GAWTC 1 cut(s) 155
Tru1I TTAA 2 cut(s) 137, 183
Tru9I TTAA 2 cut(s) 137, 183
TseFI GTSAC 1 cut(s) 94
TseI GCWGC 3 cut(s) 83, 86, 170
Tsp45I GTSAC 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 47
XbaI TCTAGA 1 cut(s) 158
XspI CTAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.