Rroxscaffold_1G00037620

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
54789583 .. 54798357
8775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00037620.1

Sequence Viewer

Length: 405 bp
ATGGAGAGGAATCAAGGGAATCTAGGTTGGGTTGCTGGTAATGGATGGGATGTTGCTGGGTTGCCTAGGGTTGCTGCTGGGTCGAGAGAGAGAGCTAGGCGCGAGAAGGAAAATTCTACGATGCACCAACACATCCGCAACAATGAAGATCGGTTCTATGCGGTGGTAGGCTGCTTCACTTCCGCCCATCAATCAGAGCCTGAAATTCAGCCCCAATTCCATCCCTATTTCTGCCGCCGACTTCTGCCCTATCGAGCCAGCTCCGGCCACCAAATTTCAGCCACCATTCAACCCGATTACCGCCGTGACCTGATATTTTCCCATACGGCTTCGGCGGGAGCTGGCGGATCACACCGGCCTCCCCAAAGCTGGGCGAGTTGCAAATCTGGGAATTTCGAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

134

Amino Acids

15.05

Weight (kDa)

9.3

Isoelectric Point (pI)

55.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 102
AciI CCGC 7 cut(s) 136, 161, 183, 235, 301, 335, 345
AclWI GGATC 1 cut(s) 355
AcoI YGGCCR 1 cut(s) 265
AcsI RAATTY 4 cut(s) 112, 204, 273, 391
AfiI CCNNNNNNNGG 2 cut(s) 369, 370
AgsI TTSAA 1 cut(s) 290
AluBI AGCT 4 cut(s) 95, 261, 341, 369
AluI AGCT 4 cut(s) 95, 261, 341, 369
AlwI GGATC 1 cut(s) 355
AlwNI CAGNNNCTG 1 cut(s) 200
AoxI GGCC 2 cut(s) 265, 356
ApeKI GCWGC 2 cut(s) 74, 171
ApoI RAATTY 4 cut(s) 112, 204, 273, 391
AspA2I CCTAGG 1 cut(s) 65
AspLEI GCGC 1 cut(s) 102
AvrII CCTAGG 1 cut(s) 65
BbvI GCAGC 2 cut(s) 61, 158
BccI CCATC 3 cut(s) 39, 195, 228
BceAI ACGGC 2 cut(s) 288, 342
BfaI CTAG 3 cut(s) 23, 66, 96
BisI GCNGC 3 cut(s) 75, 172, 235
BlnI CCTAGG 1 cut(s) 65
BlsI GCNGC 3 cut(s) 76, 173, 236
BmsI GCATC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 65
Bsc4I CCNNNNNNNGG 2 cut(s) 369, 370
Bse118I RCCGGY 1 cut(s) 354
BseDI CCNNGG 1 cut(s) 65
BseGI GGATG 4 cut(s) 50, 55, 132, 220
BseLI CCNNNNNNNGG 2 cut(s) 369, 370
BseXI GCAGC 2 cut(s) 61, 158
BseYI CCCAGC 3 cut(s) 56, 77, 369
Bsh1236I CGCG 1 cut(s) 102
BshFI GGCC 2 cut(s) 267, 358
BsiSI CCGG 2 cut(s) 264, 355
BslI CCNNNNNNNGG 2 cut(s) 369, 370
BsnI GGCC 2 cut(s) 267, 358
Bsp143I GATC 2 cut(s) 148, 347
BspACI CCGC 7 cut(s) 136, 161, 183, 235, 301, 335, 345
BspANI GGCC 2 cut(s) 267, 358
BspFNI CGCG 1 cut(s) 102
BspPI GGATC 1 cut(s) 355
BsrFI RCCGGY 1 cut(s) 354
BssAI RCCGGY 1 cut(s) 354
BssECI CCNNGG 1 cut(s) 65
BssMI GATC 2 cut(s) 148, 347
BssT1I CCWWGG 1 cut(s) 65
BstC8I GCNNGC 2 cut(s) 259, 343
BstF5I GGATG 4 cut(s) 50, 55, 132, 220
BstFNI CGCG 1 cut(s) 102
BstHHI GCGC 1 cut(s) 102
BstKTI GATC 2 cut(s) 151, 350
BstMBI GATC 2 cut(s) 148, 347
BstUI CGCG 1 cut(s) 102
BstV1I GCAGC 2 cut(s) 61, 158
BsuRI GGCC 2 cut(s) 267, 358
BtsCI GGATG 4 cut(s) 50, 55, 132, 220
Cac8I GCNNGC 2 cut(s) 259, 343
CaiI CAGNNNCTG 1 cut(s) 200
CfoI GCGC 1 cut(s) 102
Cfr10I RCCGGY 1 cut(s) 354
DpnI GATC 2 cut(s) 150, 349
DpnII GATC 2 cut(s) 148, 347
EaeI YGGCCR 1 cut(s) 265
EciI GGCGGA 2 cut(s) 172, 360
Eco130I CCWWGG 1 cut(s) 65
EcoT14I CCWWGG 1 cut(s) 65
ErhI CCWWGG 1 cut(s) 65
FaiI YATR 2 cut(s) 159, 324
FauI CCCGC 1 cut(s) 328
Fnu4HI GCNGC 3 cut(s) 75, 172, 235
FokI GGATG 4 cut(s) 57, 62, 119, 207
Fsp4HI GCNGC 3 cut(s) 75, 172, 235
FspBI CTAG 3 cut(s) 23, 66, 96
GlaI GCGC 1 cut(s) 101
GluI GCNGC 3 cut(s) 75, 172, 235
GsaI CCCAGC 3 cut(s) 60, 81, 373
HaeIII GGCC 2 cut(s) 267, 358
HapII CCGG 2 cut(s) 264, 355
HhaI GCGC 1 cut(s) 102
Hin6I GCGC 1 cut(s) 100
HinP1I GCGC 1 cut(s) 100
HinfI GANTC 2 cut(s) 10, 19
HpaII CCGG 2 cut(s) 264, 355
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 84
HpyAV CCTTC 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 124, 381
HspAI GCGC 1 cut(s) 100
Kzo9I GATC 2 cut(s) 148, 347
LmnI GCTCC 2 cut(s) 266, 338
Lsp1109I GCAGC 2 cut(s) 61, 158
LweI GCATC 1 cut(s) 111
MaeI CTAG 3 cut(s) 23, 66, 96
MaeIII GTNAC 1 cut(s) 305
MalI GATC 2 cut(s) 150, 349
MboI GATC 2 cut(s) 148, 347
MboII GAAGA 1 cut(s) 158
MluCI AATT 5 cut(s) 112, 204, 215, 273, 391
MnlI CCTC 2 cut(s) 369, 391
MspI CCGG 2 cut(s) 264, 355
MvnI CGCG 1 cut(s) 102
NdeII GATC 2 cut(s) 148, 347
NmuCI GTSAC 1 cut(s) 305
PfeI GAWTC 2 cut(s) 10, 19
PkrI GCNGC 3 cut(s) 76, 173, 236
PspFI CCCAGC 3 cut(s) 56, 77, 369
PstNI CAGNNNCTG 1 cut(s) 200
SatI GCNGC 3 cut(s) 75, 172, 235
Sau3AI GATC 2 cut(s) 148, 347
SetI ASST 7 cut(s) 28, 97, 263, 312, 343, 371, 402
SfaNI GCATC 1 cut(s) 111
Sse9I AATT 5 cut(s) 112, 204, 215, 273, 391
SsiI CCGC 7 cut(s) 136, 161, 183, 235, 301, 335, 345
SspMI CTAG 3 cut(s) 23, 66, 96
StyI CCWWGG 1 cut(s) 65
TaqI TCGA 3 cut(s) 83, 253, 396
TasI AATT 5 cut(s) 112, 204, 215, 273, 391
TauI GCSGC 1 cut(s) 237
TfiI GAWTC 2 cut(s) 10, 19
TseFI GTSAC 1 cut(s) 305
TseI GCWGC 2 cut(s) 74, 171
Tsp45I GTSAC 1 cut(s) 305
TspDTI ATGAA 1 cut(s) 159
XapI RAATTY 4 cut(s) 112, 204, 273, 391
XmaJI CCTAGG 1 cut(s) 65
XspI CTAG 3 cut(s) 23, 66, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.