Rroxscaffold_1G00063030

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
85032265 .. 85032922
658 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00063030.1

Sequence Viewer

Length: 222 bp
ATGTTGGGGAAGAAGAGGTGGTTGTTGTTTAGGAGGTCGATGAGAAAGGAATCCTGGAGTGTTAGGTGGAAGTATTTGGGGTCTGCCTTCAAGTTTAGGCCGGTGAATCTCCAGCTTTCTTTCTACGATGACGTTGTGTTCAAGATTGTTTCAGTTTTTGAGGCTATAGTGTTGGCTCTCAGCATCGCTTTCTTCTACCTTTGCTGCGGTTGCAGCTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.7

Weight (kDa)

9.95

Isoelectric Point (pI)

60.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 207
AgsI TTSAA 2 cut(s) 91, 142
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 2 cut(s) 115, 216
AluI AGCT 2 cut(s) 115, 216
AlwNI CAGNNNCTG 1 cut(s) 219
AoxI GGCC 1 cut(s) 98
ApeKI GCWGC 2 cut(s) 204, 213
AsuHPI GGTGA 1 cut(s) 115
BbvI GCAGC 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 55
BfmI CTRYAG 1 cut(s) 165
BisI GCNGC 2 cut(s) 205, 214
BlsI GCNGC 2 cut(s) 206, 215
Bme1390I CCNGG 1 cut(s) 55
BmrFI CCNGG 1 cut(s) 55
BmsI GCATC 1 cut(s) 192
BpmI CTGGAG 2 cut(s) 76, 95
Bse118I RCCGGY 1 cut(s) 100
BseBI CCWGG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 193
BseXI GCAGC 1 cut(s) 191
BshFI GGCC 1 cut(s) 100
BsiSI CCGG 1 cut(s) 101
BsnI GGCC 1 cut(s) 100
BspACI CCGC 1 cut(s) 207
BspANI GGCC 1 cut(s) 100
BspCNI CTCAG 1 cut(s) 192
BsrFI RCCGGY 1 cut(s) 100
BssAI RCCGGY 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 55
Bst6I CTCTTC 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 179
BstMWI GCNNNNNNNGC 2 cut(s) 210, 213
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 165
BstV1I GCAGC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 169
CaiI CAGNNNCTG 1 cut(s) 219
Cfr10I RCCGGY 1 cut(s) 100
CviJI RGCY 5 cut(s) 100, 115, 164, 176, 216
CviKI_1 RGCY 5 cut(s) 100, 115, 164, 176, 216
DdeI CTNAG 1 cut(s) 179
Eam1104I CTCTTC 1 cut(s) 8
EarI CTCTTC 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 53
FaiI YATR 1 cut(s) 167
Fnu4HI GCNGC 2 cut(s) 205, 214
Fsp4HI GCNGC 2 cut(s) 205, 214
GluI GCNGC 2 cut(s) 205, 214
GsuI CTGGAG 2 cut(s) 76, 95
HaeIII GGCC 1 cut(s) 100
HapII CCGG 1 cut(s) 101
HinfI GANTC 2 cut(s) 50, 106
HpaII CCGG 1 cut(s) 101
HphI GGTGA 1 cut(s) 115
Hpy188I TCNGA 1 cut(s) 221
Hpy188III TCNNGA 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 132
HpyCH4V TGCA 1 cut(s) 213
HpyF10VI GCNNNNNNNGC 2 cut(s) 210, 213
HpyF3I CTNAG 1 cut(s) 179
HpySE526I ACGT 1 cut(s) 132
LpnPI CCDG 4 cut(s) 40, 67, 114, 125
Lsp1109I GCAGC 1 cut(s) 191
LweI GCATC 1 cut(s) 192
MaeII ACGT 1 cut(s) 132
MboII GAAGA 3 cut(s) 22, 25, 184
MnlI CCTC 3 cut(s) 9, 27, 154
MspI CCGG 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 55
MvaI CCWGG 1 cut(s) 55
MwoI GCNNNNNNNGC 2 cut(s) 210, 213
PfeI GAWTC 2 cut(s) 50, 106
PfoI TCCNGGA 1 cut(s) 53
PkrI GCNGC 2 cut(s) 206, 215
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PstNI CAGNNNCTG 1 cut(s) 219
SatI GCNGC 2 cut(s) 205, 214
ScrFI CCNGG 1 cut(s) 55
SetI ASST 7 cut(s) 20, 38, 68, 117, 135, 201, 218
SfaNI GCATC 1 cut(s) 192
SfcI CTRYAG 1 cut(s) 165
SgeI CNNG 6 cut(s) 66, 67, 103, 113, 124, 154
SsiI CCGC 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 53
TaiI ACGT 1 cut(s) 135
TaqI TCGA 1 cut(s) 38
TfiI GAWTC 2 cut(s) 50, 106
TseI GCWGC 2 cut(s) 204, 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.