Rroxscaffold_1G00064990

WD domain, G-beta repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0008398
Physical Location & Seq
Forward (+)
86799722 .. 86803154
3433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00064990.1

Sequence Viewer

Length: 603 bp
ATGTGGGACTTTTCCAAGGGGCGCCCAAACAAAATAATAAATTTTGGTTTGTCTGATGTAAATAATGGTGGTGAGCAGTGTCTTAATCCTGCCTTTGTCCATGCAATAGCAGTTCCAGAAATTGATATGTTAGACAAATCAGACAAGGTTTGTGTTGTGGCTCGGGGTGATGGTGCAGTTGATGTGATTAATATTGAAGCTGAACTTGATTCTGTAAGGTCGAAAGGTTCTACAAAACCTCGGAAAGGATCTCAATCAAGATCCAAAAACACCAATCTGGAAATCCAAGATCAAAATAGAAGGAATAGATTGCATTTGGATTACTCATCAGGCGGTCATACTGCTGCTGTGTCTTGCGTGGCATTTTCGTTATTTGGGGAAAGAGGAAGATTTATAGTTTCAGGCGGAAACGACAAGCTGGTAAAGGTCTGGGATTGGACCAGGTATCTTGATGCAGAACAAACTAGCGGCAGTGGTGATCTTCTACATTTGAATATCGACCACAGCAAAAAAGTCAACTGGCTGTGTACCACTCCAGGTGATGTGGAAAACCTAGTTGTTTGTGATACAACTAAGGTGGTAAAGGTCTACTCTGTTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WD40

Protein Analysis

200

Amino Acids

21.95

Weight (kDa)

6.95

Isoelectric Point (pI)

30.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WD40 PF00400 111 - 145 4.1e-07 WD domain, G-beta repeat
Beta-prop_THOC3 PF25174 113 - 199 5.7e-07 THOC3 beta-propeller domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 21
AccI GTMKAC 1 cut(s) 588
AciI CCGC 3 cut(s) 333, 405, 468
AclWI GGATC 2 cut(s) 255, 256
AcsI RAATTY 1 cut(s) 40
AcyI GRCGYC 1 cut(s) 22
AfaI GTAC 1 cut(s) 529
AfiI CCNNNNNNNGG 1 cut(s) 245
AgsI TTSAA 2 cut(s) 197, 493
AjnI CCWGG 2 cut(s) 440, 535
AluBI AGCT 2 cut(s) 200, 418
AluI AGCT 2 cut(s) 200, 418
AlwI GGATC 2 cut(s) 255, 256
Ama87I CYCGRG 1 cut(s) 162
ApeKI GCWGC 1 cut(s) 344
ApoI RAATTY 1 cut(s) 40
AseI ATTAAT 1 cut(s) 189
AspLEI GCGC 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 438
AsuHPI GGTGA 4 cut(s) 83, 179, 488, 551
AvaI CYCGRG 1 cut(s) 162
AvaII GGWCC 1 cut(s) 438
BanI GGYRCC 1 cut(s) 21
BbvI GCAGC 1 cut(s) 331
BccI CCATC 1 cut(s) 164
BciT130I CCWGG 2 cut(s) 442, 537
BfaI CTAG 2 cut(s) 465, 554
BfoI RGCGCY 1 cut(s) 25
BisI GCNGC 2 cut(s) 345, 469
BlsI GCNGC 2 cut(s) 346, 470
Bme1390I CCNGG 2 cut(s) 442, 537
Bme18I GGWCC 1 cut(s) 438
BmeT110I CYCGRG 1 cut(s) 162
BmgT120I GGNCC 1 cut(s) 438
BmiI GGNNCC 1 cut(s) 23
BmrFI CCNGG 2 cut(s) 442, 537
BmsI GCATC 1 cut(s) 442
BpmI CTGGAG 1 cut(s) 519
BsaBI GATNNNNATC 1 cut(s) 253
BsaHI GRCGYC 1 cut(s) 22
BsaJI CCNNGG 2 cut(s) 15, 239
Bsc4I CCNNNNNNNGG 1 cut(s) 245
Bse1I ACTGG 1 cut(s) 524
Bse8I GATNNNNATC 1 cut(s) 253
BseBI CCWGG 2 cut(s) 442, 537
BseDI CCNNGG 2 cut(s) 15, 239
BseJI GATNNNNATC 1 cut(s) 253
BseLI CCNNNNNNNGG 1 cut(s) 245
BseNI ACTGG 1 cut(s) 524
BseXI GCAGC 1 cut(s) 331
BsgI GTGCAG 1 cut(s) 195
BshNI GGYRCC 1 cut(s) 21
BsiHKCI CYCGRG 1 cut(s) 162
BslFI GGGAC 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 245
BsmFI GGGAC 1 cut(s) 20
BsoBI CYCGRG 1 cut(s) 162
Bsp143I GATC 4 cut(s) 248, 260, 289, 478
BspACI CCGC 3 cut(s) 333, 405, 468
BspLI GGNNCC 1 cut(s) 23
BspPI GGATC 2 cut(s) 255, 256
BspT107I GGYRCC 1 cut(s) 21
BsrI ACTGG 1 cut(s) 524
BssECI CCNNGG 2 cut(s) 15, 239
BssMI GATC 4 cut(s) 248, 260, 289, 478
BssNI GRCGYC 1 cut(s) 22
BssT1I CCWWGG 1 cut(s) 15
Bst2UI CCWGG 2 cut(s) 442, 537
BstACI GRCGYC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 573
BstENI CCTNNNNNAGG 1 cut(s) 243
BstH2I RGCGCY 1 cut(s) 25
BstHHI GCGC 1 cut(s) 24
BstKTI GATC 4 cut(s) 251, 263, 292, 481
BstMBI GATC 4 cut(s) 248, 260, 289, 478
BstNI CCWGG 2 cut(s) 442, 537
BstSCI CCNGG 2 cut(s) 440, 535
BstV1I GCAGC 1 cut(s) 331
BstX2I RGATCY 2 cut(s) 248, 260
BstYI RGATCY 2 cut(s) 248, 260
BtsI GCAGTG 2 cut(s) 83, 478
BtsIMutI CAGTG 2 cut(s) 83, 478
CfoI GCGC 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 438
CsiI ACCWGGT 1 cut(s) 440
Csp6I GTAC 1 cut(s) 528
CspCI CAANNNNNGTGG 2 cut(s) 558, 593
CviAII CATG 1 cut(s) 101
CviJI RGCY 4 cut(s) 161, 200, 418, 523
CviKI_1 RGCY 4 cut(s) 161, 200, 418, 523
CviQI GTAC 1 cut(s) 528
DdeI CTNAG 1 cut(s) 573
DinI GGCGCC 1 cut(s) 23
DpnI GATC 4 cut(s) 250, 262, 291, 480
DpnII GATC 4 cut(s) 248, 260, 289, 478
EciI GGCGGA 1 cut(s) 420
Eco130I CCWWGG 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 438
Eco88I CYCGRG 1 cut(s) 162
EcoNI CCTNNNNNAGG 1 cut(s) 243
EcoRII CCWGG 2 cut(s) 440, 535
EcoT14I CCWWGG 1 cut(s) 15
EgeI GGCGCC 1 cut(s) 23
EheI GGCGCC 1 cut(s) 23
ErhI CCWWGG 1 cut(s) 15
FaeI CATG 1 cut(s) 104
FaiI YATR 5 cut(s) 102, 128, 339, 395, 601
FalI AAGNNNNNCTT 2 cut(s) 189, 221
FaqI GGGAC 1 cut(s) 20
FatI CATG 1 cut(s) 100
FblI GTMKAC 1 cut(s) 588
Fnu4HI GCNGC 2 cut(s) 345, 469
Fsp4HI GCNGC 2 cut(s) 345, 469
FspBI CTAG 2 cut(s) 465, 554
GlaI GCGC 1 cut(s) 23
GluI GCNGC 2 cut(s) 345, 469
GsuI CTGGAG 1 cut(s) 519
HaeII RGCGCY 1 cut(s) 25
HhaI GCGC 1 cut(s) 24
Hin1I GRCGYC 1 cut(s) 22
Hin1II CATG 1 cut(s) 104
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
HincII GTYRAC 1 cut(s) 517
HindII GTYRAC 1 cut(s) 517
HinfI GANTC 1 cut(s) 209
HphI GGTGA 4 cut(s) 83, 179, 488, 551
Hpy166II GTNNAC 3 cut(s) 517, 528, 589
Hpy188I TCNGA 3 cut(s) 55, 142, 243
Hpy188III TCNNGA 4 cut(s) 116, 258, 278, 449
Hpy8I GTNNAC 3 cut(s) 517, 528, 589
HpyAV CCTTC 1 cut(s) 294
HpyCH4V TGCA 5 cut(s) 104, 176, 313, 455, 599
HpyF3I CTNAG 1 cut(s) 573
Hsp92I GRCGYC 1 cut(s) 22
Hsp92II CATG 1 cut(s) 104
HspAI GCGC 1 cut(s) 22
KasI GGCGCC 1 cut(s) 21
Kzo9I GATC 4 cut(s) 248, 260, 289, 478
Lsp1109I GCAGC 1 cut(s) 331
LweI GCATC 1 cut(s) 442
MabI ACCWGGT 1 cut(s) 440
MaeI CTAG 2 cut(s) 465, 554
MalI GATC 4 cut(s) 250, 262, 291, 480
MboI GATC 4 cut(s) 248, 260, 289, 478
MboII GAAGA 2 cut(s) 399, 473
MflI RGATCY 2 cut(s) 248, 260
MluCI AATT 2 cut(s) 40, 120
Mly113I GGCGCC 1 cut(s) 22
MnlI CCTC 2 cut(s) 249, 377
MseI TTAA 2 cut(s) 84, 189
MspR9I CCNGG 2 cut(s) 442, 537
MvaI CCWGG 2 cut(s) 442, 537
NarI GGCGCC 1 cut(s) 22
NdeII GATC 4 cut(s) 248, 260, 289, 478
NlaIII CATG 1 cut(s) 104
NlaIV GGNNCC 1 cut(s) 23
PfeI GAWTC 1 cut(s) 209
PkrI GCNGC 2 cut(s) 346, 470
PluTI GGCGCC 1 cut(s) 25
PshBI ATTAAT 1 cut(s) 189
Psp6I CCWGG 2 cut(s) 440, 535
PspGI CCWGG 2 cut(s) 440, 535
PspN4I GGNNCC 1 cut(s) 23
PspPI GGNCC 1 cut(s) 438
PsuI RGATCY 2 cut(s) 248, 260
RsaI GTAC 1 cut(s) 529
RsaNI GTAC 1 cut(s) 528
SaqAI TTAA 2 cut(s) 84, 189
SatI GCNGC 2 cut(s) 345, 469
Sau3AI GATC 4 cut(s) 248, 260, 289, 478
Sau96I GGNCC 1 cut(s) 438
ScrFI CCNGG 2 cut(s) 442, 537
SexAI ACCWGGT 1 cut(s) 440
SfaNI GCATC 1 cut(s) 442
SfoI GGCGCC 1 cut(s) 23
SinI GGWCC 1 cut(s) 438
Sse9I AATT 2 cut(s) 40, 120
SsiI CCGC 3 cut(s) 333, 405, 468
SspDI GGCGCC 1 cut(s) 21
SspI AATATT 1 cut(s) 193
SspMI CTAG 2 cut(s) 465, 554
StyD4I CCNGG 2 cut(s) 440, 535
StyI CCWWGG 1 cut(s) 15
TaqI TCGA 2 cut(s) 221, 498
TasI AATT 2 cut(s) 40, 120
TauI GCSGC 1 cut(s) 471
TfiI GAWTC 1 cut(s) 209
Tru1I TTAA 2 cut(s) 84, 189
Tru9I TTAA 2 cut(s) 84, 189
TscAI CASTG 2 cut(s) 83, 478
TseI GCWGC 1 cut(s) 344
TspRI CASTG 2 cut(s) 83, 478
VpaK11BI GGWCC 1 cut(s) 438
VspI ATTAAT 1 cut(s) 189
XagI CCTNNNNNAGG 1 cut(s) 243
XapI RAATTY 1 cut(s) 40
XmiI GTMKAC 1 cut(s) 588
XspI CTAG 2 cut(s) 465, 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.