Rroxscaffold_1G00071310

mitochondrial gene expression

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
92175236 .. 92179180
3945 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00071310.1

Sequence Viewer

Length: 174 bp
ATGAAACCAGAACATGACCAATATGTTTATCGCCACCCCAATGGATTGTGTGTGATTGGTTTGGCTGCATCACATGTGGCTCTTAAGGAAGAAGGGGGTATCACAGCCATTGATTTCAATGTTGGAAAATCGGATCACAGTGGGCTTAAGGTTACTGGAAAGCGCAAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.2

Weight (kDa)

9.25

Isoelectric Point (pI)

2.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012232)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 141
AflII CTTAAG 2 cut(s) 83, 146
AflIII ACRYGT 1 cut(s) 73
AgsI TTSAA 1 cut(s) 118
AlwI GGATC 1 cut(s) 141
ApeKI GCWGC 1 cut(s) 65
AspLEI GCGC 1 cut(s) 165
BbvI GCAGC 1 cut(s) 52
BfrI CTTAAG 2 cut(s) 83, 146
BisI GCNGC 1 cut(s) 66
BlsI GCNGC 1 cut(s) 67
BmsI GCATC 1 cut(s) 77
Bse1I ACTGG 1 cut(s) 160
BseNI ACTGG 1 cut(s) 160
BseXI GCAGC 1 cut(s) 52
Bsp143I GATC 1 cut(s) 133
BspPI GGATC 1 cut(s) 141
BspTI CTTAAG 2 cut(s) 83, 146
BsrI ACTGG 1 cut(s) 160
BssMI GATC 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 140
BstAFI CTTAAG 2 cut(s) 83, 146
BstHHI GCGC 1 cut(s) 165
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 77
BstV1I GCAGC 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 41
BtsIMutI CAGTG 1 cut(s) 145
CfoI GCGC 1 cut(s) 165
CviAII CATG 2 cut(s) 14, 74
CviJI RGCY 4 cut(s) 65, 80, 107, 145
CviKI_1 RGCY 4 cut(s) 65, 80, 107, 145
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
FaeI CATG 2 cut(s) 17, 77
FaiI YATR 3 cut(s) 15, 24, 75
FatI CATG 2 cut(s) 13, 73
Fnu4HI GCNGC 1 cut(s) 66
Fsp4HI GCNGC 1 cut(s) 66
GlaI GCGC 1 cut(s) 164
GluI GCNGC 1 cut(s) 66
HhaI GCGC 1 cut(s) 165
Hin1II CATG 2 cut(s) 17, 77
Hin6I GCGC 1 cut(s) 163
HinP1I GCGC 1 cut(s) 163
Hpy188I TCNGA 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 1 cut(s) 68
Hsp92II CATG 2 cut(s) 17, 77
HspAI GCGC 1 cut(s) 163
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 2 cut(s) 21, 141
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 77
MaeIII GTNAC 1 cut(s) 151
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 103
MseI TTAA 2 cut(s) 84, 147
MslI CAYNNNNRTG 1 cut(s) 39
MspCI CTTAAG 2 cut(s) 83, 146
NdeII GATC 1 cut(s) 133
NlaIII CATG 2 cut(s) 17, 77
NspI RCATGY 1 cut(s) 77
PciI ACATGT 1 cut(s) 73
PkrI GCNGC 1 cut(s) 67
PscI ACATGT 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 39
SaqAI TTAA 2 cut(s) 84, 147
SatI GCNGC 1 cut(s) 66
Sau3AI GATC 1 cut(s) 133
SetI ASST 1 cut(s) 153
SfaNI GCATC 1 cut(s) 77
SgeI CNNG 4 cut(s) 20, 26, 86, 168
SmiMI CAYNNNNRTG 1 cut(s) 39
SmlI CTYRAG 2 cut(s) 83, 146
SmoI CTYRAG 2 cut(s) 83, 146
TaaI ACNGT 1 cut(s) 140
Tru1I TTAA 2 cut(s) 84, 147
Tru9I TTAA 2 cut(s) 84, 147
TscAI CASTG 1 cut(s) 145
TseI GCWGC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 145
Vha464I CTTAAG 2 cut(s) 83, 146
XceI RCATGY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.