Rroxscaffold_1G00074190

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
95112855 .. 95115982
3128 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00074190.1

Sequence Viewer

Length: 210 bp
ATGGACCCAAATTTAGGGCAGAACAGACTTGAAGATGTCAGCTGGCTCTGTTCCCTCTCTGAGTCTGAGCTTGATTTGCTGATCAGCTTAAAGAAGCTTGTTCTCCAAAGGGCAGGAGTGATTGGGCATGAAGAACTAGCAGTCAAGTTTGATCTCAAGGTGCTTAGAGCTCTTGGTATCGTTTGTTCTGATGACGTGTATCAAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.75

Weight (kDa)

4.9

Isoelectric Point (pI)

27.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AfiI CCNNNNNNNGG 1 cut(s) 14
AflIII ACRYGT 1 cut(s) 195
AgsI TTSAA 1 cut(s) 32
AjiI CACGTC 1 cut(s) 196
AluBI AGCT 5 cut(s) 42, 70, 87, 97, 170
AluI AGCT 5 cut(s) 42, 70, 87, 97, 170
Alw21I GWGCWC 1 cut(s) 172
ApoI RAATTY 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 172
Bbv12I GWGCWC 1 cut(s) 172
BclI TGATCA 1 cut(s) 81
BfaI CTAG 1 cut(s) 137
Bme18I GGWCC 1 cut(s) 4
BmgBI CACGTC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 14
BseLI CCNNNNNNNGG 1 cut(s) 14
BseMII CTCAG 2 cut(s) 51, 57
BsiHKAI GWGCWC 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 14
Bsp1286I GDGCHC 1 cut(s) 172
Bsp143I GATC 2 cut(s) 81, 151
BspCNI CTCAG 2 cut(s) 52, 58
BspLI GGNNCC 1 cut(s) 6
BssMI GATC 2 cut(s) 81, 151
BstC8I GCNNGC 1 cut(s) 44
BstDEI CTNAG 3 cut(s) 60, 66, 164
BstKTI GATC 2 cut(s) 84, 154
BstMBI GATC 2 cut(s) 81, 151
BstMWI GCNNNNNNNGC 1 cut(s) 76
BtrI CACGTC 1 cut(s) 196
Cac8I GCNNGC 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 1 cut(s) 128
CviJI RGCY 6 cut(s) 42, 46, 70, 87, 97, 170
CviKI_1 RGCY 6 cut(s) 42, 46, 70, 87, 97, 170
DdeI CTNAG 3 cut(s) 60, 66, 164
DpnI GATC 2 cut(s) 83, 153
DpnII GATC 2 cut(s) 81, 151
Ecl136II GAGCTC 1 cut(s) 170
Eco24I GRGCYC 1 cut(s) 172
Eco47I GGWCC 1 cut(s) 4
Eco53kI GAGCTC 1 cut(s) 170
EcoICRI GAGCTC 1 cut(s) 170
EcoT38I GRGCYC 1 cut(s) 172
FaeI CATG 1 cut(s) 131
FaiI YATR 1 cut(s) 129
FatI CATG 1 cut(s) 127
FbaI TGATCA 1 cut(s) 81
FriOI GRGCYC 1 cut(s) 172
FspBI CTAG 1 cut(s) 137
Hin1II CATG 1 cut(s) 131
HindIII AAGCTT 1 cut(s) 95
HinfI GANTC 1 cut(s) 62
Hpy188I TCNGA 3 cut(s) 61, 67, 190
HpyCH4IV ACGT 1 cut(s) 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 3 cut(s) 60, 66, 164
HpySE526I ACGT 1 cut(s) 195
Hsp92II CATG 1 cut(s) 131
Ksp22I TGATCA 1 cut(s) 81
Kzo9I GATC 2 cut(s) 81, 151
LpnPI CCDG 2 cut(s) 28, 99
MaeI CTAG 1 cut(s) 137
MaeII ACGT 1 cut(s) 195
MalI GATC 2 cut(s) 83, 153
MboI GATC 2 cut(s) 81, 151
MboII GAAGA 2 cut(s) 44, 143
MhlI GDGCHC 1 cut(s) 172
MluCI AATT 1 cut(s) 10
MlyI GAGTC 1 cut(s) 71
MnlI CCTC 1 cut(s) 65
MseI TTAA 1 cut(s) 89
MspA1I CMGCKG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 76
NdeII GATC 2 cut(s) 81, 151
NlaIII CATG 1 cut(s) 131
NlaIV GGNNCC 1 cut(s) 6
PleI GAGTC 1 cut(s) 70
PpsI GAGTC 1 cut(s) 70
Psp124BI GAGCTC 1 cut(s) 172
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
PsrI GAACNNNNNNTAC 2 cut(s) 169, 201
PvuII CAGCTG 1 cut(s) 42
SacI GAGCTC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 89
Sau3AI GATC 2 cut(s) 81, 151
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 71
SduI GDGCHC 1 cut(s) 172
SetI ASST 7 cut(s) 44, 72, 89, 99, 162, 172, 198
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 1 cut(s) 10
SspMI CTAG 1 cut(s) 137
SstI GAGCTC 1 cut(s) 172
TaiI ACGT 1 cut(s) 198
TasI AATT 1 cut(s) 10
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 10
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.