Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0008381

Physical Location & Seq

Genomic Coordinates Reverse (-)

999728 .. 1003702

Gene Structure 3975 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00077470.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 717 bp

ATGGGTGCATGTGCTTCGGCTCATAGGGAATCCGGGTCGGCCACGAAACTCGGAATGTCTTTCGGGTCCAAACCGGACAAGCTCTCCAGCCTCTCCTCTATTCTACCGTCCCCGGTCAAAGAGAAACCGACGACAAACGGTGGCCGTCCGATCAACGATCAATGGTCGCCTGCTCGCCCCACAGCCACGGCTTTCCGAGACTACGGTAGTAAAGATGAGGCCTTCTTTGATTCCAAGCCTTGGTTGGACTCAGATTGTGAAGATGACTTCTACAGTGTCAATGGCGACTTTACTCCATCTCGTGGCAACACTCCGGTCCATCAGAACTTCTCTCGTGTCAACAAAACTCCTTTTGAGAACAGAAGTCCTGTTTCTATACCTGCTCCATCTCCAATACAACAGAAAAAGAAACTTGCTGATCTCTTTCGCGAGAGCTTCAGAGATGGTGATCATGTTGATGATGCAACAGATCACTCCGGTGATCAAACCATGACTAATGGAAAGATGGAAGTGAAGCCCACTGCCCAAGACCTCCCTCCAAAATCTCTGAATGGTACTCCTAATGTTTCTGGTAGCGAAAGGACAGCCAATGAAGATCTAACTGAAGACAGACCAATTAAATCTACACAATGCTGCCTTCCTACATTTGTTTCTTTTCGCAGCTCTAGTCAGAGGGGGAAGATGAGCCCTACCATTGCTGTAGTTGACAAAGCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

238

Amino Acids

25.89

Weight (kDa)

6.43

Isoelectric Point (pI)

50.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008381)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G27210 AT5G40860 AT5G40860
fragaria_vesca	FvH4_6g53190 FvH4_6g53190 FvH4_6g53190
malus_domestica	MD09G1013200.v1.1 MD17G1013900.v1.1
prunus_persica	Prupe.3G303900_v2.0.a1 Prupe.3G303900_v2.0.a1
pyrus_communis	pycom111g01120 pycom17g01100
rosa_chinensis	RchiOBHm_Chr2g0175231
rosa_laevigata	RLG00000022313
rosa_multiflora	Rmu_sc0015795.1_g000003
rosa_roxburghii	Rroxscaffold_2G00077470
rosa_rugosa	Rorug02G0581800 Rorug02G0581900
rosa_samantha	Rh2AG662300 Rh2BG673500 Rh2CG636700 Rh2DG687400
rosa_wichuraiana	Rw2G054320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	388
AccB7I	CCANNNNNTGG	2 cut(s)	240, 302
AccII	CGCG	1 cut(s)	429
AcoI	YGGCCR	2 cut(s)	39, 142
AcuI	CTGAAG	2 cut(s)	421, 624
AfaI	GTAC	1 cut(s)	556
AfiI	CCNNNNNNNGG	2 cut(s)	240, 302
AleI	CACNNNNGTG	1 cut(s)	477
AluBI	AGCT	4 cut(s)	82, 435, 663, 713
AluI	AGCT	4 cut(s)	82, 435, 663, 713
Alw26I	GTCTC	1 cut(s)	192
AoxI	GGCC	3 cut(s)	39, 142, 219
ApeKI	GCWGC	2 cut(s)	633, 660
AspS9I	GGNCC	2 cut(s)	66, 316
AsuC2I	CCSGG	2 cut(s)	34, 113
AsuHPI	GGTGA	2 cut(s)	458, 491
AvaII	GGWCC	2 cut(s)	66, 316
BanII	GRGCYC	1 cut(s)	689
BauI	CACGAG	2 cut(s)	300, 333
BbsI	GAAGAC	1 cut(s)	612
BbvI	GCAGC	2 cut(s)	620, 672
BccI	CCATC	5 cut(s)	304, 327, 394, 437, 499
BceAI	ACGGC	2 cut(s)	129, 204
BcgI	CGANNNNNNTGC	1 cut(s)	31
BclI	TGATCA	2 cut(s)	448, 481
BcnI	CCSGG	2 cut(s)	34, 113
BcoDI	GTCTC	1 cut(s)	192
BfaI	CTAG	1 cut(s)	666
BfmI	CTRYAG	2 cut(s)	271, 699
BfuAI	ACCTGC	1 cut(s)	388
BglII	AGATCT	1 cut(s)	595
BisI	GCNGC	2 cut(s)	634, 661
BlsI	GCNGC	2 cut(s)	635, 662
Bme1390I	CCNGG	2 cut(s)	34, 113
Bme18I	GGWCC	2 cut(s)	66, 316
BmgT120I	GGNCC	2 cut(s)	66, 316
BmiI	GGNNCC	1 cut(s)	67
BmrFI	CCNGG	2 cut(s)	34, 113
BmsI	GCATC	1 cut(s)	451
BpiI	GAAGAC	1 cut(s)	612
BpmI	CTGGAG	1 cut(s)	70
BpuMI	CCSGG	2 cut(s)	34, 113
BsaBI	GATNNNNATC	1 cut(s)	447
BsaJI	CCNNGG	3 cut(s)	111, 186, 239
BsaWI	WCCGGW	3 cut(s)	73, 313, 476
BsaXI	ACNNNNNCTCC	2 cut(s)	68, 98
Bsc4I	CCNNNNNNNGG	2 cut(s)	240, 302
Bse3DI	GCAATG	1 cut(s)	693
Bse8I	GATNNNNATC	1 cut(s)	447
BseDI	CCNNGG	3 cut(s)	111, 186, 239
BseJI	GATNNNNATC	1 cut(s)	447
BseLI	CCNNNNNNNGG	2 cut(s)	240, 302
BseMI	GCAATG	1 cut(s)	693
BseMII	CTCAG	1 cut(s)	264
BseRI	GAGGAG	1 cut(s)	85
BseXI	GCAGC	2 cut(s)	620, 672
Bsh1236I	CGCG	1 cut(s)	429
BshFI	GGCC	3 cut(s)	41, 144, 221
BsiSI	CCGG	5 cut(s)	33, 74, 113, 314, 477
BslFI	GGGAC	1 cut(s)	94
BslI	CCNNNNNNNGG	2 cut(s)	240, 302
BsmAI	GTCTC	1 cut(s)	192
BsmFI	GGGAC	1 cut(s)	94
BsnI	GGCC	3 cut(s)	41, 144, 221
Bsp1286I	GDGCHC	1 cut(s)	689
Bsp143I	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
Bsp68I	TCGCGA	1 cut(s)	429
BspANI	GGCC	3 cut(s)	41, 144, 221
BspCNI	CTCAG	1 cut(s)	263
BspFNI	CGCG	1 cut(s)	429
BspLI	GGNNCC	1 cut(s)	67
BspMI	ACCTGC	1 cut(s)	388
BsrDI	GCAATG	1 cut(s)	693
BssECI	CCNNGG	3 cut(s)	111, 186, 239
BssMI	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
BssSI	CACGAG	2 cut(s)	300, 333
BssT1I	CCWWGG	1 cut(s)	239
Bst2BI	CACGAG	2 cut(s)	300, 333
Bst4CI	ACNGT	4 cut(s)	108, 140, 206, 275
BstC8I	GCNNGC	2 cut(s)	171, 175
BstDEI	CTNAG	1 cut(s)	250
BstDSI	CCRYGG	1 cut(s)	186
BstFNI	CGCG	1 cut(s)	429
BstKTI	GATC	7 cut(s)	153, 160, 421, 451, 472, 484, 598
BstMAI	GTCTC	1 cut(s)	192
BstMBI	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
BstNSI	RCATGY	1 cut(s)	12
BstSCI	CCNGG	2 cut(s)	32, 111
BstSFI	CTRYAG	2 cut(s)	271, 699
BstUI	CGCG	1 cut(s)	429
BstV1I	GCAGC	2 cut(s)	620, 672
BstV2I	GAAGAC	1 cut(s)	612
BstX2I	RGATCY	1 cut(s)	595
BstYI	RGATCY	1 cut(s)	595
BsuRI	GGCC	3 cut(s)	41, 144, 221
BtgI	CCRYGG	1 cut(s)	186
BtsI	GCAGTG	1 cut(s)	519
BtsIMutI	CAGTG	2 cut(s)	280, 519
BtuMI	TCGCGA	1 cut(s)	429
BveI	ACCTGC	1 cut(s)	388
Cac8I	GCNNGC	2 cut(s)	171, 175
Cfr13I	GGNCC	2 cut(s)	66, 316
Csp6I	GTAC	1 cut(s)	555
CviAII	CATG	3 cut(s)	9, 452, 490
CviQI	GTAC	1 cut(s)	555
DdeI	CTNAG	1 cut(s)	250
DpnI	GATC	7 cut(s)	152, 159, 420, 450, 471, 483, 597
DpnII	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
EaeI	YGGCCR	2 cut(s)	39, 142
Eco130I	CCWWGG	1 cut(s)	239
Eco147I	AGGCCT	1 cut(s)	221
Eco24I	GRGCYC	1 cut(s)	689
Eco47I	GGWCC	2 cut(s)	66, 316
Eco57I	CTGAAG	2 cut(s)	421, 624
EcoT14I	CCWWGG	1 cut(s)	239
EcoT38I	GRGCYC	1 cut(s)	689
ErhI	CCWWGG	1 cut(s)	239
FaeI	CATG	3 cut(s)	12, 455, 493
FaiI	YATR	5 cut(s)	10, 24, 377, 453, 491
FaqI	GGGAC	1 cut(s)	94
FatI	CATG	3 cut(s)	8, 451, 489
FbaI	TGATCA	2 cut(s)	448, 481
Fnu4HI	GCNGC	2 cut(s)	634, 661
FriOI	GRGCYC	1 cut(s)	689
Fsp4HI	GCNGC	2 cut(s)	634, 661
FspBI	CTAG	1 cut(s)	666
GluI	GCNGC	2 cut(s)	634, 661
GsuI	CTGGAG	1 cut(s)	70
HaeIII	GGCC	3 cut(s)	41, 144, 221
HapII	CCGG	5 cut(s)	33, 74, 113, 314, 477
Hin1II	CATG	3 cut(s)	12, 455, 493
HincII	GTYRAC	2 cut(s)	340, 706
HindII	GTYRAC	2 cut(s)	340, 706
HindIII	AAGCTT	1 cut(s)	711
HinfI	GANTC	3 cut(s)	29, 230, 248
HpaII	CCGG	5 cut(s)	33, 74, 113, 314, 477
HphI	GGTGA	2 cut(s)	458, 491
Hpy166II	GTNNAC	2 cut(s)	340, 706
Hpy188I	TCNGA	8 cut(s)	53, 150, 197, 253, 324, 440, 549, 672
Hpy188III	TCNNGA	1 cut(s)	428
Hpy8I	GTNNAC	2 cut(s)	340, 706
Hpy99I	CGWCG	1 cut(s)	133
HpyAV	CCTTC	2 cut(s)	232, 647
HpyCH4III	ACNGT	4 cut(s)	108, 140, 206, 275
HpyCH4V	TGCA	2 cut(s)	8, 464
HpyF3I	CTNAG	1 cut(s)	250
Hsp92II	CATG	3 cut(s)	12, 455, 493
Ksp22I	TGATCA	2 cut(s)	448, 481
Kzo9I	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
LmnI	GCTCC	1 cut(s)	388
Lsp1109I	GCAGC	2 cut(s)	620, 672
LweI	GCATC	1 cut(s)	451
MaeI	CTAG	1 cut(s)	666
MalI	GATC	7 cut(s)	152, 159, 420, 450, 471, 483, 597
MboI	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
MboII	GAAGA	4 cut(s)	272, 605, 617, 691
MflI	RGATCY	1 cut(s)	595
MhlI	GDGCHC	1 cut(s)	689
MluCI	AATT	1 cut(s)	615
MlyI	GAGTC	1 cut(s)	242
MmeI	TCCRAC	1 cut(s)	225
MnlI	CCTC	6 cut(s)	101, 106, 211, 542, 546, 666
MseI	TTAA	1 cut(s)	618
MslI	CAYNNNNRTG	2 cut(s)	456, 477
MspI	CCGG	5 cut(s)	33, 74, 113, 314, 477
MspR9I	CCNGG	2 cut(s)	34, 113
MvnI	CGCG	1 cut(s)	429
NciI	CCSGG	2 cut(s)	34, 113
NdeII	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
NlaIII	CATG	3 cut(s)	12, 455, 493
NlaIV	GGNNCC	1 cut(s)	67
NruI	TCGCGA	1 cut(s)	429
NspI	RCATGY	1 cut(s)	12
OliI	CACNNNNGTG	1 cut(s)	477
PceI	AGGCCT	1 cut(s)	221
PfeI	GAWTC	2 cut(s)	29, 230
PflMI	CCANNNNNTGG	2 cut(s)	240, 302
PkrI	GCNGC	2 cut(s)	635, 662
PleI	GAGTC	1 cut(s)	242
PpsI	GAGTC	1 cut(s)	242
PspN4I	GGNNCC	1 cut(s)	67
PspPI	GGNCC	2 cut(s)	66, 316
PsuI	RGATCY	1 cut(s)	595
RruI	TCGCGA	1 cut(s)	429
RsaI	GTAC	1 cut(s)	556
RsaNI	GTAC	1 cut(s)	555
RseI	CAYNNNNRTG	2 cut(s)	456, 477
SaqAI	TTAA	1 cut(s)	618
SatI	GCNGC	2 cut(s)	634, 661
Sau3AI	GATC	7 cut(s)	150, 157, 418, 448, 469, 481, 595
Sau96I	GGNCC	2 cut(s)	66, 316
SchI	GAGTC	1 cut(s)	242
ScrFI	CCNGG	2 cut(s)	34, 113
SduI	GDGCHC	1 cut(s)	689
SetI	ASST	6 cut(s)	84, 382, 437, 534, 665, 715
SfaNI	GCATC	1 cut(s)	451
SfcI	CTRYAG	2 cut(s)	271, 699
SinI	GGWCC	2 cut(s)	66, 316
SmiMI	CAYNNNNRTG	2 cut(s)	456, 477
Sse9I	AATT	1 cut(s)	615
SseBI	AGGCCT	1 cut(s)	221
SspMI	CTAG	1 cut(s)	666
StuI	AGGCCT	1 cut(s)	221
StyD4I	CCNGG	2 cut(s)	32, 111
StyI	CCWWGG	1 cut(s)	239
TaaI	ACNGT	4 cut(s)	108, 140, 206, 275
TasI	AATT	1 cut(s)	615
TfiI	GAWTC	2 cut(s)	29, 230
Tru1I	TTAA	1 cut(s)	618
Tru9I	TTAA	1 cut(s)	618
TscAI	CASTG	2 cut(s)	280, 526
TseI	GCWGC	2 cut(s)	633, 660
TspDTI	ATGAA	1 cut(s)	606
TspRI	CASTG	2 cut(s)	280, 526
Van91I	CCANNNNNTGG	2 cut(s)	240, 302
VpaK11BI	GGWCC	2 cut(s)	66, 316
XceI	RCATGY	1 cut(s)	12
XcmI	CCANNNNNNNNNTGG	1 cut(s)	241
XspI	CTAG	1 cut(s)	666

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.