Rroxscaffold_4G00280630

deSI-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
3133684 .. 3137271
3588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00280630.1

Sequence Viewer

Length: 738 bp
ATGGTCATTTTGGGTTCTGTGAACAAGGAAGTGGTGTTTTTCAGTTGTCCATCAGGAAAAAATCCAATGTACACATATCGCGAATGCATCGTCCTTGGAAAAACAGATTGTTCAATCTTCAAGGTCAATCAAATCTTGAGGGAACTCAGTAGAGAGTGGCCTGGGTTTACTTATGACTTGTTATCAAAAAATTGCAATCACTTTTGTGATGAGCTATGCGAAAGACTTGGGGTGCCAAAGCTTCCAGGTTGGGTTAATCGCTTTGCACATGCGGGTGATGCTGCAATGGAAGTAGCAGGAAACACAGCAGTACGGTTTAAACAAGCCAAGACAGAGATTGTATCGGCGAGCAAAGTTGCTTATCGATTCCTTGTTGGCGTCACTAACAATGTCATAGCTTCTCCCGAAGCTCCTGGAAATTCAAATAGAGGGACCCCTAGATTTCAATCAGCTTGGTTCAAAAGCCTAATCCCTAATGGAGCCAAACCGTCTAGTAGTTCTGAATTTGATAGTGAAGAGAATGCACTTCGGCAGCAACAGCAGACAGATTCAGACTTGCCGCTACCACGACATTCTCGACCTTTGCAGCAGACAGATTCAGACTTGCTGCTACCACAGCACTCTCGACCATTGCAGCAGACAGATTCAGACTTGCCGCTACCACAACATTCTCGACCATTGCAGCAGACAGATTCAGACTTGCCGCTACCACAACATTCTCGACCATTGCATAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

245

Amino Acids

27.36

Weight (kDa)

7.66

Isoelectric Point (pI)

53.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_C97 PF05903 13 - 97 5.3e-27 PPPDE putative peptidase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013336)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G25660 AT4G25680
fragaria_vesca FvH4_7g30180
malus_domestica MD01G1207800.v1.1 MD07G1278400.v1.1
prunus_persica Prupe.2G300300_v2.0.a1
pyrus_communis pycom01g21860 pycom07g25340
rosa_chinensis RchiOBHm_Chr1g0378231
rosa_laevigata RLG00000026458
rosa_multiflora Rmu_sc0038642.1_g000003
rosa_roxburghii Rroxscaffold_4G00280630
rosa_rugosa Rorug01G0407200
rosa_samantha Rh1AG422500 Rh1BG386600 Rh1CG400200 Rh1DG417800
rosa_wichuraiana Rw1G037490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 232
AccII CGCG 1 cut(s) 81
AciI CCGC 4 cut(s) 272, 560, 656, 704
AcsI RAATTY 2 cut(s) 418, 503
AcyI GRCGYC 1 cut(s) 378
AfaI GTAC 2 cut(s) 71, 312
AgsI TTSAA 5 cut(s) 114, 121, 423, 446, 460
AjnI CCWGG 3 cut(s) 160, 244, 412
AleI CACNNNNGTG 1 cut(s) 204
AluBI AGCT 5 cut(s) 214, 241, 398, 410, 452
AluI AGCT 5 cut(s) 214, 241, 398, 410, 452
AoxI GGCC 1 cut(s) 158
ApeKI GCWGC 6 cut(s) 281, 532, 586, 607, 634, 682
ApoI RAATTY 2 cut(s) 418, 503
ArsI GACNNNNNNTTYG 2 cut(s) 75, 107
AspS9I GGNCC 1 cut(s) 432
AsuHPI GGTGA 1 cut(s) 287
AvaII GGWCC 1 cut(s) 432
BanI GGYRCC 1 cut(s) 232
BbvI GCAGC 6 cut(s) 268, 544, 594, 598, 646, 694
BccI CCATC 1 cut(s) 58
BciT130I CCWGG 3 cut(s) 162, 246, 414
BfaI CTAG 2 cut(s) 438, 492
BisI GCNGC 9 cut(s) 282, 533, 560, 587, 608, 635, 656, 683, 704
BlsI GCNGC 9 cut(s) 283, 534, 561, 588, 609, 636, 657, 684, 705
Bme1390I CCNGG 3 cut(s) 162, 246, 414
Bme18I GGWCC 1 cut(s) 432
BmgT120I GGNCC 1 cut(s) 432
BmiI GGNNCC 4 cut(s) 234, 433, 434, 481
BmrFI CCNGG 3 cut(s) 162, 246, 414
BmsI GCATC 2 cut(s) 96, 268
BpuEI CTTGAG 1 cut(s) 157
Bsa29I ATCGAT 1 cut(s) 364
BsaBI GATNNNNATC 1 cut(s) 445
BsaHI GRCGYC 1 cut(s) 378
BsaJI CCNNGG 2 cut(s) 94, 161
Bse3DI GCAATG 4 cut(s) 291, 629, 677, 725
Bse8I GATNNNNATC 1 cut(s) 445
BseBI CCWGG 3 cut(s) 162, 246, 414
BseCI ATCGAT 1 cut(s) 364
BseDI CCNNGG 2 cut(s) 94, 161
BseJI GATNNNNATC 1 cut(s) 445
BseMI GCAATG 4 cut(s) 291, 629, 677, 725
BseMII CTCAG 1 cut(s) 160
BseXI GCAGC 6 cut(s) 268, 544, 594, 598, 646, 694
Bsh1236I CGCG 1 cut(s) 81
BshFI GGCC 1 cut(s) 160
BshNI GGYRCC 1 cut(s) 232
BshVI ATCGAT 1 cut(s) 364
BslFI GGGAC 1 cut(s) 445
BsmFI GGGAC 1 cut(s) 445
BsmI GAATGC 2 cut(s) 89, 526
BsnI GGCC 1 cut(s) 160
Bsp1407I TGTACA 1 cut(s) 69
Bsp68I TCGCGA 1 cut(s) 81
BspACI CCGC 4 cut(s) 272, 560, 656, 704
BspANI GGCC 1 cut(s) 160
BspCNI CTCAG 1 cut(s) 159
BspDI ATCGAT 1 cut(s) 364
BspFNI CGCG 1 cut(s) 81
BspLI GGNNCC 4 cut(s) 234, 433, 434, 481
BspT107I GGYRCC 1 cut(s) 232
BsrDI GCAATG 4 cut(s) 291, 629, 677, 725
BsrGI TGTACA 1 cut(s) 69
BssECI CCNNGG 2 cut(s) 94, 161
BssNI GRCGYC 1 cut(s) 378
BssT1I CCWWGG 1 cut(s) 94
Bst2UI CCWGG 3 cut(s) 162, 246, 414
Bst4CI ACNGT 2 cut(s) 315, 489
Bst6I CTCTTC 1 cut(s) 510
BstACI GRCGYC 1 cut(s) 378
BstAUI TGTACA 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 349
BstDEI CTNAG 1 cut(s) 146
BstFNI CGCG 1 cut(s) 81
BstMWI GCNNNNNNNGC 3 cut(s) 278, 538, 616
BstNI CCWGG 3 cut(s) 162, 246, 414
BstNSI RCATGY 1 cut(s) 272
BstSCI CCNGG 3 cut(s) 160, 244, 412
BstUI CGCG 1 cut(s) 81
BstV1I GCAGC 6 cut(s) 268, 544, 594, 598, 646, 694
Bsu15I ATCGAT 1 cut(s) 364
BsuRI GGCC 1 cut(s) 160
BsuTUI ATCGAT 1 cut(s) 364
BtuMI TCGCGA 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 349
Cfr13I GGNCC 1 cut(s) 432
ClaI ATCGAT 1 cut(s) 364
CseI GACGC 1 cut(s) 367
Csp6I GTAC 2 cut(s) 70, 311
CviAII CATG 1 cut(s) 269
CviJI RGCY 9 cut(s) 160, 214, 241, 326, 398, 410, 452, 465, 482
CviKI_1 RGCY 9 cut(s) 160, 214, 241, 326, 398, 410, 452, 465, 482
CviQI GTAC 2 cut(s) 70, 311
DdeI CTNAG 1 cut(s) 146
DraI TTTAAA 1 cut(s) 319
Eam1104I CTCTTC 1 cut(s) 510
EarI CTCTTC 1 cut(s) 510
Eco130I CCWWGG 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 432
EcoO109I RGGNCCY 1 cut(s) 432
EcoRII CCWGG 3 cut(s) 160, 244, 412
EcoT14I CCWWGG 1 cut(s) 94
EcoT22I ATGCAT 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 272
FaiI YATR 6 cut(s) 76, 174, 217, 270, 395, 732
FaqI GGGAC 1 cut(s) 445
FatI CATG 1 cut(s) 268
FauI CCCGC 1 cut(s) 265
Fnu4HI GCNGC 9 cut(s) 282, 533, 560, 587, 608, 635, 656, 683, 704
Fsp4HI GCNGC 9 cut(s) 282, 533, 560, 587, 608, 635, 656, 683, 704
FspBI CTAG 2 cut(s) 438, 492
GluI GCNGC 9 cut(s) 282, 533, 560, 587, 608, 635, 656, 683, 704
HaeIII GGCC 1 cut(s) 160
HgaI GACGC 1 cut(s) 367
Hin1I GRCGYC 1 cut(s) 378
Hin1II CATG 1 cut(s) 272
HindIII AAGCTT 1 cut(s) 239
HinfI GANTC 5 cut(s) 366, 548, 596, 644, 692
HphI GGTGA 1 cut(s) 287
Hpy166II GTNNAC 3 cut(s) 22, 72, 168
Hpy188I TCNGA 5 cut(s) 502, 553, 601, 649, 697
Hpy188III TCNNGA 8 cut(s) 54, 80, 136, 404, 576, 624, 672, 720
Hpy8I GTNNAC 3 cut(s) 22, 72, 168
HpyCH4III ACNGT 2 cut(s) 315, 489
HpyCH4V TGCA 9 cut(s) 87, 195, 266, 284, 524, 586, 634, 682, 730
HpyF10VI GCNNNNNNNGC 3 cut(s) 278, 538, 616
HpyF3I CTNAG 1 cut(s) 146
Hsp92I GRCGYC 1 cut(s) 378
Hsp92II CATG 1 cut(s) 272
KflI GGGWCCC 1 cut(s) 432
LmnI GCTCC 2 cut(s) 415, 479
LpnPI CCDG 8 cut(s) 39, 147, 174, 231, 258, 282, 399, 426
Lsp1109I GCAGC 6 cut(s) 268, 544, 594, 598, 646, 694
LweI GCATC 2 cut(s) 96, 268
MaeI CTAG 2 cut(s) 438, 492
MaeIII GTNAC 1 cut(s) 379
MboII GAAGA 2 cut(s) 109, 527
MluCI AATT 3 cut(s) 190, 418, 503
MnlI CCTC 2 cut(s) 132, 422
Mph1103I ATGCAT 1 cut(s) 89
MseI TTAA 2 cut(s) 255, 318
MslI CAYNNNNRTG 2 cut(s) 204, 273
MspR9I CCNGG 3 cut(s) 162, 246, 414
MssI GTTTAAAC 1 cut(s) 319
Mva1269I GAATGC 2 cut(s) 89, 526
MvaI CCWGG 3 cut(s) 162, 246, 414
MvnI CGCG 1 cut(s) 81
MwoI GCNNNNNNNGC 3 cut(s) 278, 538, 616
NlaIII CATG 1 cut(s) 272
NlaIV GGNNCC 4 cut(s) 234, 433, 434, 481
NmuCI GTSAC 1 cut(s) 379
NruI TCGCGA 1 cut(s) 81
NsiI ATGCAT 1 cut(s) 89
NspI RCATGY 1 cut(s) 272
OliI CACNNNNGTG 1 cut(s) 204
PcsI WCGNNNNNNNCGW 1 cut(s) 574
PctI GAATGC 2 cut(s) 89, 526
PfeI GAWTC 5 cut(s) 366, 548, 596, 644, 692
PfoI TCCNGGA 1 cut(s) 412
PkrI GCNGC 9 cut(s) 283, 534, 561, 588, 609, 636, 657, 684, 705
PmeI GTTTAAAC 1 cut(s) 319
PpuMI RGGWCCY 1 cut(s) 432
Psp5II RGGWCCY 1 cut(s) 432
Psp6I CCWGG 3 cut(s) 160, 244, 412
PspGI CCWGG 3 cut(s) 160, 244, 412
PspN4I GGNNCC 4 cut(s) 234, 433, 434, 481
PspPI GGNCC 1 cut(s) 432
PspPPI RGGWCCY 1 cut(s) 432
RruI TCGCGA 1 cut(s) 81
RsaI GTAC 2 cut(s) 71, 312
RsaNI GTAC 2 cut(s) 70, 311
RseI CAYNNNNRTG 2 cut(s) 204, 273
SaqAI TTAA 2 cut(s) 255, 318
SatI GCNGC 9 cut(s) 282, 533, 560, 587, 608, 635, 656, 683, 704
Sau96I GGNCC 1 cut(s) 432
ScrFI CCNGG 3 cut(s) 162, 246, 414
SetI ASST 8 cut(s) 126, 216, 243, 250, 400, 412, 454, 583
SfaNI GCATC 2 cut(s) 96, 268
SinI GGWCC 1 cut(s) 432
SmiMI CAYNNNNRTG 2 cut(s) 204, 273
SmlI CTYRAG 1 cut(s) 136
SmoI CTYRAG 1 cut(s) 136
Sse9I AATT 3 cut(s) 190, 418, 503
SsiI CCGC 4 cut(s) 272, 560, 656, 704
SspMI CTAG 2 cut(s) 438, 492
StyD4I CCNGG 3 cut(s) 160, 244, 412
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 2 cut(s) 315, 489
TaqI TCGA 5 cut(s) 364, 577, 625, 673, 721
TasI AATT 3 cut(s) 190, 418, 503
TatI WGTACW 1 cut(s) 69
TauI GCSGC 3 cut(s) 562, 658, 706
TfiI GAWTC 5 cut(s) 366, 548, 596, 644, 692
Tru1I TTAA 2 cut(s) 255, 318
Tru9I TTAA 2 cut(s) 255, 318
TseFI GTSAC 1 cut(s) 379
TseI GCWGC 6 cut(s) 281, 532, 586, 607, 634, 682
Tsp45I GTSAC 1 cut(s) 379
VpaK11BI GGWCC 1 cut(s) 432
XapI RAATTY 2 cut(s) 418, 503
XceI RCATGY 1 cut(s) 272
XspI CTAG 2 cut(s) 438, 492
Zsp2I ATGCAT 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.