Rroxscaffold_4G00297940

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
17851622 .. 17853592
1971 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00297940.1

Sequence Viewer

Length: 171 bp
ATGTTAGAATGCAAATATGCAAGGTGCCTGGAATTGCCTTACCAGGAGTTTCAACATTTTGTCTATATGAGAAGGATAAAGACGGATCCCAAATATTCACTCTCGGGCAAGGCTTTAGACAAATCATCAAATTCAAATCTTCTCATGTATCCTTGTCGGTATTTTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.83

Weight (kDa)

9.33

Isoelectric Point (pI)

48.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 24
AclWI GGATC 2 cut(s) 80, 93
AcsI RAATTY 1 cut(s) 130
AgsI TTSAA 2 cut(s) 53, 135
AjnI CCWGG 2 cut(s) 27, 42
AlwI GGATC 2 cut(s) 80, 93
Ama87I CYCGRG 1 cut(s) 103
ApoI RAATTY 1 cut(s) 130
AvaI CYCGRG 1 cut(s) 103
BamHI GGATCC 1 cut(s) 85
BanI GGYRCC 1 cut(s) 24
BciT130I CCWGG 2 cut(s) 29, 44
BciVI GTATCC 1 cut(s) 159
BfuI GTATCC 1 cut(s) 159
Bme1390I CCNGG 2 cut(s) 29, 44
BmeT110I CYCGRG 1 cut(s) 103
BmiI GGNNCC 2 cut(s) 26, 87
BmrFI CCNGG 2 cut(s) 29, 44
BseBI CCWGG 2 cut(s) 29, 44
BshNI GGYRCC 1 cut(s) 24
BsiHKCI CYCGRG 1 cut(s) 103
BsmI GAATGC 1 cut(s) 14
BsoBI CYCGRG 1 cut(s) 103
Bsp143I GATC 1 cut(s) 85
BspLI GGNNCC 2 cut(s) 26, 87
BspPI GGATC 2 cut(s) 80, 93
BspT107I GGYRCC 1 cut(s) 24
BssMI GATC 1 cut(s) 85
Bst2UI CCWGG 2 cut(s) 29, 44
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstNI CCWGG 2 cut(s) 29, 44
BstSCI CCNGG 2 cut(s) 27, 42
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BsuI GTATCC 1 cut(s) 159
CviAII CATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 113
CviKI_1 RGCY 1 cut(s) 113
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eco88I CYCGRG 1 cut(s) 103
EcoRII CCWGG 2 cut(s) 27, 42
FaeI CATG 1 cut(s) 148
FaiI YATR 4 cut(s) 18, 66, 68, 146
FatI CATG 1 cut(s) 144
Hin1II CATG 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 12, 20
Hsp92II CATG 1 cut(s) 148
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 4 cut(s) 14, 29, 41, 56
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 1 cut(s) 131
MflI RGATCY 1 cut(s) 85
MluCI AATT 2 cut(s) 32, 130
MspR9I CCNGG 2 cut(s) 29, 44
Mva1269I GAATGC 1 cut(s) 14
MvaI CCWGG 2 cut(s) 29, 44
NdeII GATC 1 cut(s) 85
NlaIII CATG 1 cut(s) 148
NlaIV GGNNCC 2 cut(s) 26, 87
PctI GAATGC 1 cut(s) 14
Psp6I CCWGG 2 cut(s) 27, 42
PspGI CCWGG 2 cut(s) 27, 42
PspN4I GGNNCC 2 cut(s) 26, 87
PsuI RGATCY 1 cut(s) 85
Sau3AI GATC 1 cut(s) 85
ScrFI CCNGG 2 cut(s) 29, 44
SetI ASST 2 cut(s) 26, 170
Sse9I AATT 2 cut(s) 32, 130
SspI AATATT 1 cut(s) 95
StyD4I CCNGG 2 cut(s) 27, 42
TasI AATT 2 cut(s) 32, 130
TspGWI ACGGA 1 cut(s) 98
XapI RAATTY 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.