Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0003477

Physical Location & Seq

Genomic Coordinates Forward (+)

37505840 .. 37513351

Gene Structure 7512 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00313750.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

ATGTCTTCTTGCAACTTGGGACCTCTACCTCGCCTAAAGTCAATGACTTGGACCATGGAGAACTGTAACTCCGGATCAGCTAACAAAGTGGCCGTCATTAACCTCAAGCTGCAAGATTATACCAAATCTAGTGTAGATGGAATCGAGGTGAAGTTCCAACCGACTAGGGACACTCTTGAAGCAATGTTGAGGTCATTGACCTACATCGAGAACAACTCTCAAAAAAGTATTCGCATTCCTAAGACGGCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

COMM_domain

Protein Analysis

83

Amino Acids

9.27

Weight (kDa)

9.34

Isoelectric Point (pI)

42.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003477)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g04941 FvH4_7g04941 FvH4_7g04941
malus_domestica	MD02G1265400.v1.1 MD07G1054000.v1.1
prunus_persica	Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1
pyrus_communis	pycom07g04180
rosa_chinensis	RchiOBHm_Chr1g0331031 RchiOBHm_Chr1g0338891
rosa_multiflora	Rmu_co8407023.1_g000001 Rmu_sc0002515.1_g000008
rosa_roxburghii	Rroxscaffold_1G00031570 Rroxscaffold_4G00313750 Rroxscaffold_4G00319540
rosa_rugosa	Rorug01G0091800
rosa_samantha	Rh1AG113400 Rh1BG087300 Rh1CG110300 Rh1DG119100
rosa_wichuraiana	Rw1G009250 Rw3G019960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	71
AclWI	GGATC	1 cut(s)	82
AcoI	YGGCCR	1 cut(s)	90
AgsI	TTSAA	1 cut(s)	179
AloI	GAACNNNNNNTCC	2 cut(s)	53, 85
AluBI	AGCT	2 cut(s)	80, 109
AluI	AGCT	2 cut(s)	80, 109
AlwI	GGATC	1 cut(s)	82
Aor13HI	TCCGGA	1 cut(s)	71
AoxI	GGCC	1 cut(s)	90
ApeKI	GCWGC	1 cut(s)	109
ArsI	GACNNNNNNTTYG	2 cut(s)	78, 110
AspS9I	GGNCC	2 cut(s)	20, 51
AsuHPI	GGTGA	1 cut(s)	160
AvaII	GGWCC	2 cut(s)	20, 51
BbvI	GCAGC	1 cut(s)	96
BccI	CCATC	1 cut(s)	131
BceAI	ACGGC	1 cut(s)	77
BfaI	CTAG	2 cut(s)	129, 165
BisI	GCNGC	1 cut(s)	110
BlsI	GCNGC	1 cut(s)	111
Bme18I	GGWCC	2 cut(s)	20, 51
BmgT120I	GGNCC	2 cut(s)	20, 51
BmiI	GGNNCC	1 cut(s)	21
BplI	GAGNNNNNCTC	2 cut(s)	200, 232
BpuEI	CTTGAG	1 cut(s)	89
BsaJI	CCNNGG	1 cut(s)	54
BsaWI	WCCGGW	1 cut(s)	71
BsaXI	ACNNNNNCTCC	2 cut(s)	53, 83
Bse3DI	GCAATG	1 cut(s)	189
BseAI	TCCGGA	1 cut(s)	71
BseDI	CCNNGG	1 cut(s)	54
BseMI	GCAATG	1 cut(s)	189
BseXI	GCAGC	1 cut(s)	96
BshFI	GGCC	1 cut(s)	92
BsiSI	CCGG	1 cut(s)	72
BslFI	GGGAC	2 cut(s)	33, 182
BsmFI	GGGAC	2 cut(s)	33, 182
BsmI	GAATGC	1 cut(s)	234
BsnI	GGCC	1 cut(s)	92
Bsp13I	TCCGGA	1 cut(s)	71
Bsp143I	GATC	1 cut(s)	74
Bsp19I	CCATGG	1 cut(s)	54
BspANI	GGCC	1 cut(s)	92
BspEI	TCCGGA	1 cut(s)	71
BspLI	GGNNCC	1 cut(s)	21
BspPI	GGATC	1 cut(s)	82
BsrDI	GCAATG	1 cut(s)	189
BssECI	CCNNGG	1 cut(s)	54
BssMI	GATC	1 cut(s)	74
BssT1I	CCWWGG	1 cut(s)	54
Bst4CI	ACNGT	1 cut(s)	65
BstDEI	CTNAG	2 cut(s)	240, 249
BstDSI	CCRYGG	1 cut(s)	54
BstKTI	GATC	1 cut(s)	77
BstMBI	GATC	1 cut(s)	74
BstV1I	GCAGC	1 cut(s)	96
BsuRI	GGCC	1 cut(s)	92
BtgI	CCRYGG	1 cut(s)	54
Cfr13I	GGNCC	2 cut(s)	20, 51
CviAII	CATG	1 cut(s)	55
CviJI	RGCY	4 cut(s)	80, 92, 109, 248
CviKI_1	RGCY	4 cut(s)	80, 92, 109, 248
DdeI	CTNAG	2 cut(s)	240, 249
DpnI	GATC	1 cut(s)	76
DpnII	GATC	1 cut(s)	74
EaeI	YGGCCR	1 cut(s)	90
Eco130I	CCWWGG	1 cut(s)	54
Eco47I	GGWCC	2 cut(s)	20, 51
EcoO109I	RGGNCCY	1 cut(s)	20
EcoT14I	CCWWGG	1 cut(s)	54
ErhI	CCWWGG	1 cut(s)	54
FaeI	CATG	1 cut(s)	58
FaiI	YATR	2 cut(s)	56, 120
FaqI	GGGAC	2 cut(s)	33, 182
FatI	CATG	1 cut(s)	54
Fnu4HI	GCNGC	1 cut(s)	110
Fsp4HI	GCNGC	1 cut(s)	110
FspBI	CTAG	2 cut(s)	129, 165
GluI	GCNGC	1 cut(s)	110
HaeIII	GGCC	1 cut(s)	92
HapII	CCGG	1 cut(s)	72
Hin1II	CATG	1 cut(s)	58
HinfI	GANTC	1 cut(s)	141
HpaII	CCGG	1 cut(s)	72
HphI	GGTGA	1 cut(s)	160
Hpy188III	TCNNGA	3 cut(s)	72, 176, 208
HpyCH4III	ACNGT	1 cut(s)	65
HpyCH4V	TGCA	2 cut(s)	12, 112
HpyF3I	CTNAG	2 cut(s)	240, 249
Hsp92II	CATG	1 cut(s)	58
Kpn2I	TCCGGA	1 cut(s)	71
Kzo9I	GATC	1 cut(s)	74
LpnPI	CCDG	1 cut(s)	85
Lsp1109I	GCAGC	1 cut(s)	96
MaeI	CTAG	2 cut(s)	129, 165
MaeIII	GTNAC	1 cut(s)	65
MalI	GATC	1 cut(s)	76
MboI	GATC	1 cut(s)	74
MmeI	TCCRAC	1 cut(s)	181
MnlI	CCTC	5 cut(s)	33, 39, 113, 139, 183
MroI	TCCGGA	1 cut(s)	71
MseI	TTAA	1 cut(s)	99
MspI	CCGG	1 cut(s)	72
Mva1269I	GAATGC	1 cut(s)	234
NcoI	CCATGG	1 cut(s)	54
NdeII	GATC	1 cut(s)	74
NlaIII	CATG	1 cut(s)	58
NlaIV	GGNNCC	1 cut(s)	21
PctI	GAATGC	1 cut(s)	234
PfeI	GAWTC	1 cut(s)	141
PkrI	GCNGC	1 cut(s)	111
PpuMI	RGGWCCY	1 cut(s)	20
Psp5II	RGGWCCY	1 cut(s)	20
PspN4I	GGNNCC	1 cut(s)	21
PspPI	GGNCC	2 cut(s)	20, 51
PspPPI	RGGWCCY	1 cut(s)	20
SaqAI	TTAA	1 cut(s)	99
SatI	GCNGC	1 cut(s)	110
Sau3AI	GATC	1 cut(s)	74
Sau96I	GGNCC	2 cut(s)	20, 51
SetI	ASST	8 cut(s)	25, 31, 82, 105, 111, 150, 194, 203
SinI	GGWCC	2 cut(s)	20, 51
SmlI	CTYRAG	1 cut(s)	104
SmoI	CTYRAG	1 cut(s)	104
SspMI	CTAG	2 cut(s)	129, 165
StyI	CCWWGG	1 cut(s)	54
TaaI	ACNGT	1 cut(s)	65
TaqI	TCGA	2 cut(s)	144, 207
TfiI	GAWTC	1 cut(s)	141
Tru1I	TTAA	1 cut(s)	99
Tru9I	TTAA	1 cut(s)	99
TseI	GCWGC	1 cut(s)	109
VpaK11BI	GGWCC	2 cut(s)	20, 51
XspI	CTAG	2 cut(s)	129, 165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.