Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr3

Orthogroup ID

OG0003477

Physical Location & Seq

Genomic Coordinates Forward (+)

23176501 .. 23182608

Gene Structure 6108 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw3G019960.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 216 bp

ATGTCACGGGAAGAAGACCACATTCCTGGACAAGGAGACCATGGGCTTCAAGACTATACCAAATCTAGTCTAGATGAAATCGAGGTGAAGTTCCAACTGACTAGGGACACTCTTGAAACAATGTTGAGGTCATTGACCTACATCAGAAAACAACTCTCAAGCATGATATCCCTAGAAACGCCCTCAGAGGATCAATATATATCTCGATCAACATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

COMM_domain

Protein Analysis

71

Amino Acids

8.24

Weight (kDa)

4.8

Isoelectric Point (pI)

76.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003477)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g04941 FvH4_7g04941 FvH4_7g04941
malus_domestica	MD02G1265400.v1.1 MD07G1054000.v1.1
prunus_persica	Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1 Prupe.2G058900_v2.0.a1
pyrus_communis	pycom07g04180
rosa_chinensis	RchiOBHm_Chr1g0331031 RchiOBHm_Chr1g0338891
rosa_multiflora	Rmu_co8407023.1_g000001 Rmu_sc0002515.1_g000008
rosa_roxburghii	Rroxscaffold_1G00031570 Rroxscaffold_4G00313750 Rroxscaffold_4G00319540
rosa_rugosa	Rorug01G0091800
rosa_samantha	Rh1AG113400 Rh1BG087300 Rh1CG110300 Rh1DG119100
rosa_wichuraiana	Rw1G009250 Rw3G019960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	198
AfiI	CCNNNNNNNGG	1 cut(s)	32
AgsI	TTSAA	2 cut(s)	50, 116
AjnI	CCWGG	1 cut(s)	25
Alw26I	GTCTC	1 cut(s)	30
AlwI	GGATC	1 cut(s)	198
AsuHPI	GGTGA	1 cut(s)	97
BbsI	GAAGAC	1 cut(s)	21
BciT130I	CCWGG	1 cut(s)	27
BcoDI	GTCTC	1 cut(s)	30
BfaI	CTAG	4 cut(s)	66, 71, 102, 173
Bme1390I	CCNGG	1 cut(s)	27
BmrFI	CCNGG	1 cut(s)	27
BpiI	GAAGAC	1 cut(s)	21
BpuEI	CTTGAG	1 cut(s)	142
BsaI	GGTCTC	1 cut(s)	30
BsaJI	CCNNGG	1 cut(s)	40
Bsc4I	CCNNNNNNNGG	1 cut(s)	32
BseBI	CCWGG	1 cut(s)	27
BseDI	CCNNGG	1 cut(s)	40
BseLI	CCNNNNNNNGG	1 cut(s)	32
BseMII	CTCAG	1 cut(s)	198
BslFI	GGGAC	1 cut(s)	119
BslI	CCNNNNNNNGG	1 cut(s)	32
BsmAI	GTCTC	1 cut(s)	30
BsmFI	GGGAC	1 cut(s)	119
Bso31I	GGTCTC	1 cut(s)	30
Bsp143I	GATC	2 cut(s)	190, 206
Bsp19I	CCATGG	1 cut(s)	40
BspCNI	CTCAG	1 cut(s)	197
BspPI	GGATC	1 cut(s)	198
BspTNI	GGTCTC	1 cut(s)	30
BssECI	CCNNGG	1 cut(s)	40
BssMI	GATC	2 cut(s)	190, 206
BssT1I	CCWWGG	1 cut(s)	40
Bst2UI	CCWGG	1 cut(s)	27
BstDEI	CTNAG	1 cut(s)	184
BstDSI	CCRYGG	1 cut(s)	40
BstENI	CCTNNNNNAGG	1 cut(s)	30
BstKTI	GATC	2 cut(s)	193, 209
BstMAI	GTCTC	1 cut(s)	30
BstMBI	GATC	2 cut(s)	190, 206
BstNI	CCWGG	1 cut(s)	27
BstSCI	CCNGG	1 cut(s)	25
BstV2I	GAAGAC	1 cut(s)	21
BstXI	CCANNNNNNTGG	1 cut(s)	26
BtgI	CCRYGG	1 cut(s)	40
CviAII	CATG	2 cut(s)	41, 163
CviJI	RGCY	1 cut(s)	46
CviKI_1	RGCY	1 cut(s)	46
DdeI	CTNAG	1 cut(s)	184
DpnI	GATC	2 cut(s)	192, 208
DpnII	GATC	2 cut(s)	190, 206
Eco130I	CCWWGG	1 cut(s)	40
Eco31I	GGTCTC	1 cut(s)	30
Eco32I	GATATC	1 cut(s)	168
EcoNI	CCTNNNNNAGG	1 cut(s)	30
EcoRII	CCWGG	1 cut(s)	25
EcoRV	GATATC	1 cut(s)	168
EcoT14I	CCWWGG	1 cut(s)	40
ErhI	CCWWGG	1 cut(s)	40
FaeI	CATG	2 cut(s)	44, 166
FaiI	YATR	6 cut(s)	42, 57, 164, 198, 200, 214
FaqI	GGGAC	1 cut(s)	119
FatI	CATG	2 cut(s)	40, 162
FspBI	CTAG	4 cut(s)	66, 71, 102, 173
Hin1II	CATG	2 cut(s)	44, 166
HphI	GGTGA	1 cut(s)	97
Hpy188I	TCNGA	2 cut(s)	146, 187
Hpy188III	TCNNGA	4 cut(s)	50, 71, 113, 204
HpyF3I	CTNAG	1 cut(s)	184
Hsp92II	CATG	2 cut(s)	44, 166
Kzo9I	GATC	2 cut(s)	190, 206
LpnPI	CCDG	2 cut(s)	12, 39
MaeI	CTAG	4 cut(s)	66, 71, 102, 173
MaeIII	GTNAC	1 cut(s)	3
MalI	GATC	2 cut(s)	192, 208
MboI	GATC	2 cut(s)	190, 206
MboII	GAAGA	2 cut(s)	23, 26
MmeI	TCCRAC	1 cut(s)	118
MnlI	CCTC	4 cut(s)	76, 120, 181, 193
MspR9I	CCNGG	1 cut(s)	27
MvaI	CCWGG	1 cut(s)	27
NcoI	CCATGG	1 cut(s)	40
NdeII	GATC	2 cut(s)	190, 206
NlaIII	CATG	2 cut(s)	44, 166
NmuCI	GTSAC	1 cut(s)	3
PfoI	TCCNGGA	1 cut(s)	25
Psp6I	CCWGG	1 cut(s)	25
PspGI	CCWGG	1 cut(s)	25
Sau3AI	GATC	2 cut(s)	190, 206
ScrFI	CCNGG	1 cut(s)	27
SetI	ASST	3 cut(s)	87, 131, 140
SmlI	CTYRAG	1 cut(s)	157
SmoI	CTYRAG	1 cut(s)	157
SspMI	CTAG	4 cut(s)	66, 71, 102, 173
StyD4I	CCNGG	1 cut(s)	25
StyI	CCWWGG	1 cut(s)	40
TaqI	TCGA	2 cut(s)	81, 205
TseFI	GTSAC	1 cut(s)	3
Tsp45I	GTSAC	1 cut(s)	3
TspDTI	ATGAA	1 cut(s)	90
XagI	CCTNNNNNAGG	1 cut(s)	30
XbaI	TCTAGA	1 cut(s)	70
XspI	CTAG	4 cut(s)	66, 71, 102, 173

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.