Rroxscaffold_4G00314670

Ceramide

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
38665678 .. 38669791
4114 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00314670.1

Sequence Viewer

Length: 300 bp
ATGGCAACTATAGGAAACAGGGAGCTTATTTCATATGATGAAGTTATGGCTGTTGGTGGTGATGGCTTTTTCAACCAAATTCTTAATGGATTTCTTTCTTCAAGGCATAAAGTTCCATATCCACCAACTCCTTCAGATTTCCTTGATTCTGCTAGTTGTAATGAGAGTCTCGTTGTAAATGATCCAAGTGAAACCGTTATTGAAGCTTATTCTCAGAATAATGAGCAGTCTCCCCTCCTCTCAAGTTCAAATATTAATGGCTCAGGACTCAGGAGTCTCAAATATCAATCAAGAGCCTGA

Protein Analysis

99

Amino Acids

10.75

Weight (kDa)

4.53

Isoelectric Point (pI)

74.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 273
AclWI GGATC 1 cut(s) 176
AcsI RAATTY 1 cut(s) 78
AcuI CTGAAG 1 cut(s) 117
AgsI TTSAA 4 cut(s) 73, 102, 203, 249
AluBI AGCT 2 cut(s) 25, 206
AluI AGCT 2 cut(s) 25, 206
Alw26I GTCTC 3 cut(s) 173, 234, 281
AlwI GGATC 1 cut(s) 176
ApoI RAATTY 1 cut(s) 78
AseI ATTAAT 1 cut(s) 255
AsuHPI GGTGA 1 cut(s) 71
BccI CCATC 1 cut(s) 56
BcoDI GTCTC 3 cut(s) 173, 234, 281
BfaI CTAG 1 cut(s) 153
BfmI CTRYAG 1 cut(s) 9
Bpu10I CCTNAGC 1 cut(s) 262
BpuEI CTTGAG 1 cut(s) 226
BseMII CTCAG 3 cut(s) 227, 276, 283
BseRI GAGGAG 1 cut(s) 227
BsmAI GTCTC 3 cut(s) 173, 234, 281
Bsp143I GATC 1 cut(s) 181
BspCNI CTCAG 3 cut(s) 226, 275, 282
BspPI GGATC 1 cut(s) 176
BssMI GATC 1 cut(s) 181
Bst4CI ACNGT 1 cut(s) 196
BstDEI CTNAG 3 cut(s) 213, 262, 269
BstKTI GATC 1 cut(s) 184
BstMAI GTCTC 3 cut(s) 173, 234, 281
BstMBI GATC 1 cut(s) 181
BstSFI CTRYAG 1 cut(s) 9
CviJI RGCY 6 cut(s) 25, 50, 66, 206, 261, 296
CviKI_1 RGCY 6 cut(s) 25, 50, 66, 206, 261, 296
DdeI CTNAG 3 cut(s) 213, 262, 269
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
DrdI GACNNNNNNGTC 1 cut(s) 273
DseDI GACNNNNNNGTC 1 cut(s) 273
Eco57I CTGAAG 1 cut(s) 117
FaiI YATR 6 cut(s) 11, 34, 36, 47, 108, 118
FauNDI CATATG 1 cut(s) 34
FspBI CTAG 1 cut(s) 153
HindIII AAGCTT 1 cut(s) 204
HinfI GANTC 4 cut(s) 146, 166, 267, 274
HphI GGTGA 1 cut(s) 71
Hpy188I TCNGA 2 cut(s) 136, 216
Hpy188III TCNNGA 3 cut(s) 264, 271, 291
HpyAV CCTTC 1 cut(s) 141
HpyCH4III ACNGT 1 cut(s) 196
HpyF3I CTNAG 3 cut(s) 213, 262, 269
Kzo9I GATC 1 cut(s) 181
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 3 cut(s) 4, 249, 256
MaeI CTAG 1 cut(s) 153
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MboII GAAGA 1 cut(s) 90
MluCI AATT 1 cut(s) 78
MlyI GAGTC 3 cut(s) 175, 261, 283
MnlI CCTC 2 cut(s) 245, 248
MseI TTAA 2 cut(s) 84, 255
NdeI CATATG 1 cut(s) 34
NdeII GATC 1 cut(s) 181
PfeI GAWTC 1 cut(s) 146
PleI GAGTC 3 cut(s) 174, 261, 282
PpsI GAGTC 3 cut(s) 174, 261, 282
PshBI ATTAAT 1 cut(s) 255
SaqAI TTAA 2 cut(s) 84, 255
Sau3AI GATC 1 cut(s) 181
SchI GAGTC 3 cut(s) 175, 261, 283
SetI ASST 2 cut(s) 27, 208
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 9 cut(s) 31, 114, 155, 165, 182, 198, 255, 276, 283
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 1 cut(s) 78
SspI AATATT 1 cut(s) 253
SspMI CTAG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 196
TasI AATT 1 cut(s) 78
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 84, 255
Tru9I TTAA 2 cut(s) 84, 255
TspDTI ATGAA 2 cut(s) 21, 54
VspI ATTAAT 1 cut(s) 255
XapI RAATTY 1 cut(s) 78
XcmI CCANNNNNNNNNTGG 1 cut(s) 83
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.