Rroxscaffold_5G00339180

dCTP pyrophosphatase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0003799
Physical Location & Seq
Forward (+)
7501856 .. 7503533
1678 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00339180.1

Sequence Viewer

Length: 387 bp
ATGGGAGAATTAGGAGAAGAGATTGTTGTAGGAGAAGAGATTGTGAACAACATTAGCCTGAAGGACCTCTCTAAGAAGCTAGATGAATTTGCCAAGGCCAGAGATTGGGAGAAGTACCATAGTCCCAGAAATCTACTCCTTGCTATGGTGGGAGAGGTCGGTGAGCTATCAGAAATATTCCAATGGAGAGGAGAGGTGGACAAAGGGTTACCAAATTGGGTGGACACAGATAAAGAGCATCTGGGAGAAGAGCTATCAGATGTGCTTCTTTACCTAATAAGGTTGGCTGACATATGTGGCATTGATCTTGCTGATGCTGCCTCCAAAAAGATTGTAAAGAATGCTATCAAATACCCACCACCCAAAGTCACCAAAGATCTTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 ko01100 map00240 map01100
Pfam Domains
Protein Families
MazG MazG-like

Protein Analysis

128

Amino Acids

14.43

Weight (kDa)

4.88

Isoelectric Point (pI)

14.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MazG PF03819 41 - 113 7.2e-07 MazG nucleotide pyrophosphohydrolase domain
MazG-like PF12643 52 - 121 8.2e-08 MazG-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 105
AcsI RAATTY 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 80
AfaI GTAC 1 cut(s) 116
AfiI CCNNNNNNNGG 2 cut(s) 105, 145
AluBI AGCT 3 cut(s) 79, 166, 253
AluI AGCT 3 cut(s) 79, 166, 253
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 1 cut(s) 317
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 64
AsuHPI GGTGA 2 cut(s) 173, 361
AvaII GGWCC 1 cut(s) 64
BbvI GCAGC 1 cut(s) 304
BfaI CTAG 1 cut(s) 80
BglII AGATCT 1 cut(s) 376
BisI GCNGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 319
Bme18I GGWCC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 64
BmsI GCATC 2 cut(s) 247, 304
BsaJI CCNNGG 1 cut(s) 93
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 145
BseDI CCNNGG 1 cut(s) 93
BseLI CCNNNNNNNGG 2 cut(s) 105, 145
BseRI GAGGAG 1 cut(s) 204
BseXI GCAGC 1 cut(s) 304
BshFI GGCC 1 cut(s) 98
BslFI GGGAC 1 cut(s) 108
BslI CCNNNNNNNGG 2 cut(s) 105, 145
BsmFI GGGAC 1 cut(s) 108
BsmI GAATGC 1 cut(s) 346
BsnI GGCC 1 cut(s) 98
Bsp143I GATC 2 cut(s) 304, 376
BspANI GGCC 1 cut(s) 98
BspQI GCTCTTC 1 cut(s) 243
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 2 cut(s) 304, 376
BssT1I CCWWGG 1 cut(s) 93
Bst6I CTCTTC 3 cut(s) 12, 30, 243
BstDEI CTNAG 1 cut(s) 72
BstEII GGTNACC 1 cut(s) 207
BstKTI GATC 2 cut(s) 307, 379
BstMBI GATC 2 cut(s) 304, 376
BstMWI GCNNNNNNNGC 1 cut(s) 317
BstPI GGTNACC 1 cut(s) 207
BstV1I GCAGC 1 cut(s) 304
BstX2I RGATCY 1 cut(s) 376
BstYI RGATCY 1 cut(s) 376
BsuRI GGCC 1 cut(s) 98
Cfr13I GGNCC 1 cut(s) 64
Csp6I GTAC 1 cut(s) 115
CspCI CAANNNNNGTGG 2 cut(s) 201, 236
CviJI RGCY 6 cut(s) 57, 79, 98, 166, 253, 287
CviKI_1 RGCY 6 cut(s) 57, 79, 98, 166, 253, 287
CviQI GTAC 1 cut(s) 115
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 306, 378
DpnII GATC 2 cut(s) 304, 376
Eam1104I CTCTTC 3 cut(s) 12, 30, 243
EarI CTCTTC 3 cut(s) 12, 30, 243
Eco130I CCWWGG 1 cut(s) 93
Eco47I GGWCC 1 cut(s) 64
Eco57I CTGAAG 1 cut(s) 80
Eco91I GGTNACC 1 cut(s) 207
EcoO109I RGGNCCY 1 cut(s) 64
EcoO65I GGTNACC 1 cut(s) 207
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaiI YATR 4 cut(s) 120, 146, 293, 295
FaqI GGGAC 1 cut(s) 108
FauNDI CATATG 1 cut(s) 293
Fnu4HI GCNGC 1 cut(s) 318
Fsp4HI GCNGC 1 cut(s) 318
FspBI CTAG 1 cut(s) 80
GluI GCNGC 1 cut(s) 318
HaeIII GGCC 1 cut(s) 98
HphI GGTGA 2 cut(s) 173, 361
Hpy166II GTNNAC 3 cut(s) 46, 199, 223
Hpy188I TCNGA 2 cut(s) 172, 259
Hpy8I GTNNAC 3 cut(s) 46, 199, 223
HpyAV CCTTC 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 317
HpyF3I CTNAG 1 cut(s) 72
Kzo9I GATC 2 cut(s) 304, 376
LguI GCTCTTC 1 cut(s) 243
LpnPI CCDG 4 cut(s) 71, 112, 139, 227
Lsp1109I GCAGC 1 cut(s) 304
LweI GCATC 2 cut(s) 247, 304
MaeI CTAG 1 cut(s) 80
MaeIII GTNAC 2 cut(s) 207, 367
MalI GATC 2 cut(s) 306, 378
MboI GATC 2 cut(s) 304, 376
MboII GAAGA 4 cut(s) 29, 47, 260, 371
MflI RGATCY 1 cut(s) 376
MluCI AATT 3 cut(s) 8, 86, 214
MnlI CCTC 5 cut(s) 77, 148, 182, 187, 331
MseI TTAA 1 cut(s) 385
Mva1269I GAATGC 1 cut(s) 346
MwoI GCNNNNNNNGC 1 cut(s) 317
NdeI CATATG 1 cut(s) 293
NdeII GATC 2 cut(s) 304, 376
NmuCI GTSAC 1 cut(s) 367
PciSI GCTCTTC 1 cut(s) 243
PctI GAATGC 1 cut(s) 346
PflMI CCANNNNNTGG 1 cut(s) 105
PkrI GCNGC 1 cut(s) 319
PpuMI RGGWCCY 1 cut(s) 64
Psp5II RGGWCCY 1 cut(s) 64
PspEI GGTNACC 1 cut(s) 207
PspPI GGNCC 1 cut(s) 64
PspPPI RGGWCCY 1 cut(s) 64
PsuI RGATCY 1 cut(s) 376
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SapI GCTCTTC 1 cut(s) 243
SaqAI TTAA 1 cut(s) 385
SatI GCNGC 1 cut(s) 318
Sau3AI GATC 2 cut(s) 304, 376
Sau96I GGNCC 1 cut(s) 64
SetI ASST 8 cut(s) 69, 81, 159, 168, 198, 255, 276, 284
SfaNI GCATC 2 cut(s) 247, 304
SgeI CNNG 8 cut(s) 70, 92, 106, 111, 138, 152, 254, 320
SinI GGWCC 1 cut(s) 64
Sse9I AATT 3 cut(s) 8, 86, 214
SspI AATATT 1 cut(s) 177
SspMI CTAG 1 cut(s) 80
StyI CCWWGG 1 cut(s) 93
TasI AATT 3 cut(s) 8, 86, 214
Tru1I TTAA 1 cut(s) 385
Tru9I TTAA 1 cut(s) 385
TseFI GTSAC 1 cut(s) 367
TseI GCWGC 1 cut(s) 317
Tsp45I GTSAC 1 cut(s) 367
TspDTI ATGAA 2 cut(s) 99, 371
Van91I CCANNNNNTGG 1 cut(s) 105
VpaK11BI GGWCC 1 cut(s) 64
XapI RAATTY 1 cut(s) 86
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.