Rroxscaffold_5G00345320

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
15709145 .. 15713088
3944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00345320.1

Sequence Viewer

Length: 240 bp
ATGGAGCTTCCGATCTGGTTGTCTTCCACCAAGTCGAAGAGAGCAGCCGCCTTCGGATACGAAGAGCCAAAGGTGATGAGTGGTGGTGTTGAACTTGAGCTTCCATTGGAGCTTGGCTCGGTAGATCTTGGTGAGAAAAAAATTTTGGTAAGGAAAATCTTGGTGAGGAGAGAAAATCTTGGTGAGAAGGGAAGAAATTTTGGTGAGATGGGATGGATTTTGGTGAGGAGAAGAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.98

Weight (kDa)

9.77

Isoelectric Point (pI)

57.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 48
AcsI RAATTY 2 cut(s) 141, 196
AgsI TTSAA 1 cut(s) 92
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AluBI AGCT 3 cut(s) 7, 100, 112
AluI AGCT 3 cut(s) 7, 100, 112
ApeKI GCWGC 1 cut(s) 44
ApoI RAATTY 2 cut(s) 141, 196
AsuHPI GGTGA 6 cut(s) 85, 143, 175, 194, 215, 235
BbsI GAAGAC 1 cut(s) 15
BbvI GCAGC 1 cut(s) 56
BccI CCATC 2 cut(s) 202, 207
BciVI GTATCC 1 cut(s) 50
BfuI GTATCC 1 cut(s) 50
BglII AGATCT 1 cut(s) 124
BisI GCNGC 2 cut(s) 45, 48
BlsI GCNGC 2 cut(s) 46, 49
BpiI GAAGAC 1 cut(s) 15
BplI GAGNNNNNCTC 2 cut(s) 101, 133
BpuEI CTTGAG 1 cut(s) 116
BseGI GGATG 1 cut(s) 218
BseRI GAGGAG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 56
Bsp143I GATC 2 cut(s) 12, 124
BspACI CCGC 1 cut(s) 48
BspQI GCTCTTC 1 cut(s) 57
BssMI GATC 2 cut(s) 12, 124
Bst6I CTCTTC 2 cut(s) 32, 57
BstF5I GGATG 1 cut(s) 218
BstKTI GATC 2 cut(s) 15, 127
BstMBI GATC 2 cut(s) 12, 124
BstV1I GCAGC 1 cut(s) 56
BstV2I GAAGAC 1 cut(s) 15
BstX2I RGATCY 1 cut(s) 124
BstYI RGATCY 1 cut(s) 124
BsuI GTATCC 1 cut(s) 50
BtsCI GGATG 1 cut(s) 218
CviJI RGCY 6 cut(s) 7, 47, 67, 100, 112, 117
CviKI_1 RGCY 6 cut(s) 7, 47, 67, 100, 112, 117
DpnI GATC 2 cut(s) 14, 126
DpnII GATC 2 cut(s) 12, 124
Eam1104I CTCTTC 2 cut(s) 32, 57
EarI CTCTTC 2 cut(s) 32, 57
Fnu4HI GCNGC 2 cut(s) 45, 48
FokI GGATG 1 cut(s) 225
Fsp4HI GCNGC 2 cut(s) 45, 48
GluI GCNGC 2 cut(s) 45, 48
HphI GGTGA 6 cut(s) 85, 143, 175, 194, 215, 235
Hpy188I TCNGA 2 cut(s) 12, 56
HpyAV CCTTC 2 cut(s) 61, 181
Kzo9I GATC 2 cut(s) 12, 124
LguI GCTCTTC 1 cut(s) 57
LmnI GCTCC 2 cut(s) 4, 109
Lsp1109I GCAGC 1 cut(s) 56
MalI GATC 2 cut(s) 14, 126
MboI GATC 2 cut(s) 12, 124
MboII GAAGA 4 cut(s) 15, 49, 74, 204
MflI RGATCY 1 cut(s) 124
MluCI AATT 3 cut(s) 141, 196, 235
MnlI CCTC 2 cut(s) 159, 219
NdeII GATC 2 cut(s) 12, 124
PciSI GCTCTTC 1 cut(s) 57
PkrI GCNGC 2 cut(s) 46, 49
PsuI RGATCY 1 cut(s) 124
SapI GCTCTTC 1 cut(s) 57
SatI GCNGC 2 cut(s) 45, 48
Sau3AI GATC 2 cut(s) 12, 124
SetI ASST 4 cut(s) 9, 75, 102, 114
SgeI CNNG 8 cut(s) 28, 43, 107, 125, 130, 140, 172, 191
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 3 cut(s) 141, 196, 235
SsiI CCGC 1 cut(s) 48
TaqI TCGA 1 cut(s) 35
TasI AATT 3 cut(s) 141, 196, 235
TauI GCSGC 1 cut(s) 50
TseI GCWGC 1 cut(s) 44
XapI RAATTY 2 cut(s) 141, 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.