Rorug01G0177200
MYB Family

Alcohol dehydrogenase transcription factor Myb/SANT-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
24326874 .. 24327441
568 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0177200.1

Sequence Viewer

Length: 189 bp
ATGGCCATTGTGGGTAAGCAATGGAGGCGAAAGCAAATCAGGAAGATTACGGACAAGGTGTTTGATCATTTCAAAAACGAGACAGGAAGGGCAAGTTTGAGGTTTGAGGATGTCTACATTGGTGTACTACTTGTGTACAATGATATTAACAAGCGTTTACCTGGCCCACATTTTGATCCACGTCTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.4

Weight (kDa)

10.2

Isoelectric Point (pI)

32.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 114
AclWI GGATC 1 cut(s) 170
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 2 cut(s) 126, 137
AgsI TTSAA 1 cut(s) 73
AjiI CACGTC 1 cut(s) 182
AjnI CCWGG 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 1 cut(s) 170
AoxI GGCC 2 cut(s) 3, 163
ArsI GACNNNNNNTTYG 2 cut(s) 44, 76
AspS9I GGNCC 1 cut(s) 164
BalI TGGCCA 1 cut(s) 5
BciT130I CCWGG 1 cut(s) 162
BclI TGATCA 1 cut(s) 64
BcoDI GTCTC 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 162
BmgBI CACGTC 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 162
Bse3DI GCAATG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 162
BseGI GGATG 1 cut(s) 115
BseMI GCAATG 1 cut(s) 26
BshFI GGCC 2 cut(s) 5, 165
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 2 cut(s) 5, 165
Bsp1407I TGTACA 1 cut(s) 135
Bsp143I GATC 2 cut(s) 64, 175
BspANI GGCC 2 cut(s) 5, 165
BspPI GGATC 1 cut(s) 170
BsrDI GCAATG 1 cut(s) 26
BsrGI TGTACA 1 cut(s) 135
BssMI GATC 2 cut(s) 64, 175
Bst2UI CCWGG 1 cut(s) 162
BstAUI TGTACA 1 cut(s) 135
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 2 cut(s) 67, 178
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 2 cut(s) 64, 175
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BsuRI GGCC 2 cut(s) 5, 165
BtrI CACGTC 1 cut(s) 182
BtsCI GGATG 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 164
Csp6I GTAC 2 cut(s) 125, 136
CviJI RGCY 2 cut(s) 5, 165
CviKI_1 RGCY 2 cut(s) 5, 165
CviQI GTAC 2 cut(s) 125, 136
DpnI GATC 2 cut(s) 66, 177
DpnII GATC 2 cut(s) 64, 175
EaeI YGGCCR 1 cut(s) 3
EcoRII CCWGG 1 cut(s) 160
FbaI TGATCA 1 cut(s) 64
FblI GTMKAC 1 cut(s) 114
FokI GGATG 1 cut(s) 122
HaeIII GGCC 2 cut(s) 5, 165
Hpy166II GTNNAC 4 cut(s) 115, 125, 136, 158
Hpy188III TCNNGA 1 cut(s) 40
Hpy8I GTNNAC 4 cut(s) 115, 125, 136, 158
HpyAV CCTTC 1 cut(s) 81
HpyCH4IV ACGT 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
HpySE526I ACGT 1 cut(s) 181
Ksp22I TGATCA 1 cut(s) 64
Kzo9I GATC 2 cut(s) 64, 175
LpnPI CCDG 4 cut(s) 25, 69, 147, 174
MaeII ACGT 1 cut(s) 181
MalI GATC 2 cut(s) 66, 177
MboI GATC 2 cut(s) 64, 175
MboII GAAGA 1 cut(s) 55
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 3 cut(s) 18, 93, 100
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 147
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 25
NdeII GATC 2 cut(s) 64, 175
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PspPI GGNCC 1 cut(s) 164
RsaI GTAC 2 cut(s) 126, 137
RsaNI GTAC 2 cut(s) 125, 136
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 2 cut(s) 64, 175
Sau96I GGNCC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 162
SetI ASST 4 cut(s) 60, 104, 163, 184
SgeI CNNG 9 cut(s) 52, 67, 91, 96, 105, 143, 163, 173, 174
StyD4I CCNGG 1 cut(s) 160
TaiI ACGT 1 cut(s) 184
TatI WGTACW 2 cut(s) 124, 135
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 65
XmiI GTMKAC 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.