Rorug01G0211900

Glutathione S-transferase zeta class-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
30083746 .. 30083916
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0211900.1

Sequence Viewer

Length: 171 bp
ATGTTTGAAATCCTCACAAGATTATCAGTGAAATCTTTACTGAGATTCAGATGTGTTTGCAAATCTTGGAACTCATTAATTACCAGTCCAAATTTCATAAACAACCATCTTGAAAGACATGATATGGATAGTTCTTGTGACTATTTAGTATTTACTTGTCCAGACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.68

Weight (kDa)

6.69

Isoelectric Point (pI)

47.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 2 - 33 7.1e-11 F-box domain
F-box-like PF12937 2 - 30 1.5e-07 F-box-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 91
AgsI TTSAA 2 cut(s) 8, 113
ApoI RAATTY 1 cut(s) 91
AseI ATTAAT 1 cut(s) 77
BccI CCATC 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 84, 170
BseMII CTCAG 1 cut(s) 32
BseNI ACTGG 2 cut(s) 84, 170
BspCNI CTCAG 1 cut(s) 33
BsrI ACTGG 2 cut(s) 84, 170
BstDEI CTNAG 1 cut(s) 41
BtsIMutI CAGTG 1 cut(s) 33
CviAII CATG 1 cut(s) 119
DdeI CTNAG 1 cut(s) 41
FaeI CATG 1 cut(s) 122
FaiI YATR 3 cut(s) 98, 120, 125
FatI CATG 1 cut(s) 118
FspEI CC 7 cut(s) 26, 52, 97, 102, 110, 119, 151
Hin1II CATG 1 cut(s) 122
HinfI GANTC 1 cut(s) 45
Hpy188I TCNGA 1 cut(s) 50
Hpy188III TCNNGA 2 cut(s) 110, 161
HpyCH4V TGCA 1 cut(s) 60
HpyF3I CTNAG 1 cut(s) 41
Hsp92II CATG 1 cut(s) 122
LpnPI CCDG 2 cut(s) 97, 151
MaeIII GTNAC 1 cut(s) 137
MluCI AATT 2 cut(s) 78, 91
MnlI CCTC 1 cut(s) 23
MseI TTAA 1 cut(s) 77
NlaIII CATG 1 cut(s) 122
NmuCI GTSAC 1 cut(s) 137
PfeI GAWTC 1 cut(s) 45
PshBI ATTAAT 1 cut(s) 77
SaqAI TTAA 1 cut(s) 77
SgeI CNNG 6 cut(s) 30, 78, 96, 122, 131, 147
Sse9I AATT 2 cut(s) 78, 91
TasI AATT 2 cut(s) 78, 91
TfiI GAWTC 1 cut(s) 45
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 137
Tsp45I GTSAC 1 cut(s) 137
TspDTI ATGAA 1 cut(s) 85
TspRI CASTG 1 cut(s) 33
VspI ATTAAT 1 cut(s) 77
XapI RAATTY 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.