Rorug01G0260200

ABIL1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0004948
Physical Location & Seq
Reverse (-)
36976493 .. 36977463
971 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0260200.1

Sequence Viewer

Length: 366 bp
ATGGCAGTGGCAAAATACTCGGCTCTTGCTCTGATTGCGTTTCTGGTGATCAAGGTGATGGTGATGGCAAATCAGTCATACGAAGTTGACTGGTCAATTGGAGTTGATTTCACTTATTTTGCTACTCAAAATACTTTCTTTGCTGGAGATGTATTAAATTTTCATTACGATAGCGCTAATCACAATTTGCTTATAGCAACAGATGGTGATGCATTTGATCAATGCCAGATGACACCGAACTTGGGTTTTTATAACAGTGGCAATGAAGCATTAACCTTGGTTGAACCTGGAAACTATTATTTCATGTGTGAGTATAATTGCAAATCTGATGGCATGAAGATGTCAGTGTATGTGAACAATATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.59

Weight (kDa)

4.2

Isoelectric Point (pI)

26.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 31 - 107 1.9e-13 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 252
AcsI RAATTY 1 cut(s) 157
AfeI AGCGCT 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 242
AgsI TTSAA 1 cut(s) 284
AjnI CCWGG 1 cut(s) 286
Aor51HI AGCGCT 1 cut(s) 175
ApoI RAATTY 1 cut(s) 157
AspLEI GCGC 1 cut(s) 176
AsuHPI GGTGA 4 cut(s) 58, 67, 73, 218
BccI CCATC 4 cut(s) 52, 58, 197, 323
BcgI CGANNNNNNTGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 288
BclI TGATCA 2 cut(s) 48, 217
BfoI RGCGCY 1 cut(s) 177
Bme1390I CCNGG 1 cut(s) 288
BmrFI CCNGG 1 cut(s) 288
BmsI GCATC 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 165
BsaJI CCNNGG 1 cut(s) 276
Bsc4I CCNNNNNNNGG 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 95
Bse3DI GCAATG 1 cut(s) 268
BseBI CCWGG 1 cut(s) 288
BseDI CCNNGG 1 cut(s) 276
BseLI CCNNNNNNNGG 1 cut(s) 242
BseMI GCAATG 1 cut(s) 268
BseNI ACTGG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 242
Bsp143I GATC 2 cut(s) 48, 217
BsrDI GCAATG 1 cut(s) 268
BsrI ACTGG 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 276
BssMI GATC 2 cut(s) 48, 217
BssT1I CCWWGG 1 cut(s) 276
Bst2UI CCWGG 1 cut(s) 288
Bst4CI ACNGT 1 cut(s) 257
BstH2I RGCGCY 1 cut(s) 177
BstHHI GCGC 1 cut(s) 176
BstKTI GATC 2 cut(s) 51, 220
BstMBI GATC 2 cut(s) 48, 217
BstMWI GCNNNNNNNGC 1 cut(s) 35
BstNI CCWGG 1 cut(s) 288
BstSCI CCNGG 1 cut(s) 286
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 3 cut(s) 12, 262, 351
CfoI GCGC 1 cut(s) 176
CviAII CATG 2 cut(s) 304, 334
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
DpnI GATC 2 cut(s) 50, 219
DpnII GATC 2 cut(s) 48, 217
Eco130I CCWWGG 1 cut(s) 276
Eco47III AGCGCT 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 286
EcoT14I CCWWGG 1 cut(s) 276
EcoT22I ATGCAT 1 cut(s) 214
ErhI CCWWGG 1 cut(s) 276
FaeI CATG 2 cut(s) 307, 337
FaiI YATR 8 cut(s) 79, 194, 252, 305, 315, 335, 351, 362
FatI CATG 2 cut(s) 303, 333
FbaI TGATCA 2 cut(s) 48, 217
GlaI GCGC 1 cut(s) 175
GsuI CTGGAG 1 cut(s) 165
HaeII RGCGCY 1 cut(s) 177
HhaI GCGC 1 cut(s) 176
Hin1II CATG 2 cut(s) 307, 337
Hin6I GCGC 1 cut(s) 174
HinP1I GCGC 1 cut(s) 174
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HphI GGTGA 4 cut(s) 58, 67, 73, 218
Hpy166II GTNNAC 2 cut(s) 88, 355
Hpy188I TCNGA 2 cut(s) 33, 328
Hpy8I GTNNAC 2 cut(s) 88, 355
HpyCH4III ACNGT 1 cut(s) 257
HpyCH4V TGCA 2 cut(s) 212, 321
HpyF10VI GCNNNNNNNGC 1 cut(s) 35
Hsp92II CATG 2 cut(s) 307, 337
HspAI GCGC 1 cut(s) 174
Ksp22I TGATCA 2 cut(s) 48, 217
Kzo9I GATC 2 cut(s) 48, 217
LpnPI CCDG 6 cut(s) 29, 76, 129, 239, 273, 300
LweI GCATC 1 cut(s) 199
MalI GATC 2 cut(s) 50, 219
MboI GATC 2 cut(s) 48, 217
MboII GAAGA 1 cut(s) 349
MfeI CAATTG 1 cut(s) 96
MluCI AATT 4 cut(s) 96, 157, 184, 316
Mph1103I ATGCAT 1 cut(s) 214
MseI TTAA 2 cut(s) 155, 272
MslI CAYNNNNRTG 1 cut(s) 338
MspR9I CCNGG 1 cut(s) 288
MunI CAATTG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 1 cut(s) 35
NdeII GATC 2 cut(s) 48, 217
NlaIII CATG 2 cut(s) 307, 337
NsiI ATGCAT 1 cut(s) 214
PsiI TTATAA 1 cut(s) 252
Psp6I CCWGG 1 cut(s) 286
PspGI CCWGG 1 cut(s) 286
RseI CAYNNNNRTG 1 cut(s) 338
SaqAI TTAA 2 cut(s) 155, 272
Sau3AI GATC 2 cut(s) 48, 217
ScrFI CCNGG 1 cut(s) 288
SetI ASST 3 cut(s) 57, 278, 289
SfaNI GCATC 1 cut(s) 199
SmiMI CAYNNNNRTG 1 cut(s) 338
Sse9I AATT 4 cut(s) 96, 157, 184, 316
StyD4I CCNGG 1 cut(s) 286
StyI CCWWGG 1 cut(s) 276
TaaI ACNGT 1 cut(s) 257
TasI AATT 4 cut(s) 96, 157, 184, 316
Tru1I TTAA 2 cut(s) 155, 272
Tru9I TTAA 2 cut(s) 155, 272
TscAI CASTG 3 cut(s) 12, 262, 351
TspDTI ATGAA 4 cut(s) 152, 279, 292, 350
TspRI CASTG 3 cut(s) 12, 262, 351
XapI RAATTY 1 cut(s) 157
Zsp2I ATGCAT 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.