Rorug02G0233500

RWP-RK domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
23287771 .. 23288055
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0233500.1

Sequence Viewer

Length: 285 bp
ATGTCTGTCTCATTGGAAGCTTTGGCTATGGCTGGTACAGATTGCTTTTCCGTTGCTATAGATCTTGAAGAATGGGAGCGTAGAGACTTGGAGTTGTCTCCACCACATTTACTAGCGGATGATGAAGAAGAACAAGGAAAAGGAAAAGAGGAAGCAGATCGTGGAAAGAAATTAAGAAGAAGCCCAGAAAGAGGAGAGCAACTTCAGGTTATTAGTAAGAAAATGTGGGTTAATGTCACCAACATAGAAGCTAGCCGTTGCAACCTATCTGGAAAGCTTAACTAG

Protein Analysis

94

Amino Acids

10.58

Weight (kDa)

4.91

Isoelectric Point (pI)

66.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 188
AfaI GTAC 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 68
AluBI AGCT 3 cut(s) 20, 251, 277
AluI AGCT 3 cut(s) 20, 251, 277
Alw26I GTCTC 3 cut(s) 13, 78, 102
AsuHPI GGTGA 1 cut(s) 229
AsuNHI GCTAGC 1 cut(s) 251
BceAI ACGGC 1 cut(s) 240
BcoDI GTCTC 3 cut(s) 13, 78, 102
BfaI CTAG 3 cut(s) 113, 252, 283
BfmI CTRYAG 1 cut(s) 57
BglII AGATCT 1 cut(s) 61
BmtI GCTAGC 1 cut(s) 255
Bsc4I CCNNNNNNNGG 1 cut(s) 191
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 191
BseRI GAGGAG 1 cut(s) 207
BslI CCNNNNNNNGG 1 cut(s) 191
BsmAI GTCTC 3 cut(s) 13, 78, 102
Bsp143I GATC 2 cut(s) 61, 157
BspACI CCGC 1 cut(s) 116
BspOI GCTAGC 1 cut(s) 255
BssMI GATC 2 cut(s) 61, 157
BstC8I GCNNGC 1 cut(s) 253
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 2 cut(s) 64, 160
BstMAI GTCTC 3 cut(s) 13, 78, 102
BstMBI GATC 2 cut(s) 61, 157
BstSFI CTRYAG 1 cut(s) 57
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BtsCI GGATG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 36
CviJI RGCY 7 cut(s) 20, 26, 32, 183, 251, 255, 277
CviKI_1 RGCY 7 cut(s) 20, 26, 32, 183, 251, 255, 277
CviQI GTAC 1 cut(s) 36
DpnI GATC 2 cut(s) 63, 159
DpnII GATC 2 cut(s) 61, 157
Eco57I CTGAAG 1 cut(s) 188
FaiI YATR 3 cut(s) 29, 59, 245
FokI GGATG 1 cut(s) 131
FspBI CTAG 3 cut(s) 113, 252, 283
HindIII AAGCTT 2 cut(s) 18, 275
HphI GGTGA 1 cut(s) 229
Hpy188III TCNNGA 2 cut(s) 65, 270
HpyCH4V TGCA 1 cut(s) 261
Kzo9I GATC 2 cut(s) 61, 157
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 18, 191, 198, 255
MaeI CTAG 3 cut(s) 113, 252, 283
MaeIII GTNAC 1 cut(s) 235
MalI GATC 2 cut(s) 63, 159
MboI GATC 2 cut(s) 61, 157
MboII GAAGA 4 cut(s) 80, 137, 140, 189
MflI RGATCY 1 cut(s) 61
MluCI AATT 1 cut(s) 170
MnlI CCTC 2 cut(s) 142, 185
MseI TTAA 3 cut(s) 173, 231, 279
NdeII GATC 2 cut(s) 61, 157
NheI GCTAGC 1 cut(s) 251
NmuCI GTSAC 1 cut(s) 235
PsuI RGATCY 1 cut(s) 61
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 3 cut(s) 173, 231, 279
Sau3AI GATC 2 cut(s) 61, 157
SetI ASST 5 cut(s) 22, 210, 253, 267, 279
SfcI CTRYAG 1 cut(s) 57
SgeI CNNG 9 cut(s) 45, 77, 100, 125, 146, 173, 197, 218, 264
Sse9I AATT 1 cut(s) 170
SsiI CCGC 1 cut(s) 116
SspMI CTAG 3 cut(s) 113, 252, 283
TasI AATT 1 cut(s) 170
Tru1I TTAA 3 cut(s) 173, 231, 279
Tru9I TTAA 3 cut(s) 173, 231, 279
TseFI GTSAC 1 cut(s) 235
Tsp45I GTSAC 1 cut(s) 235
TspDTI ATGAA 1 cut(s) 138
TspGWI ACGGA 1 cut(s) 40
XspI CTAG 3 cut(s) 113, 252, 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.