Rorug02G0624000
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
73993012 .. 73993200
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0624000.1

Sequence Viewer

Length: 189 bp
ATGTCGTTTCCAGAAAGTCAGTTGAATAAAGCAAATGAGTTGGCTCCCATATTTAATGAACTTGTTGATCGAGTGAGTTTGGATACGAGATTCCTGCAGGATTCACTGTCCAGAACAAAGAAAGCAGATCCTTTTACATCTAGACTTCTAGATATTCATGCCAAGATGCTAGAGAATAACAAGAAATAG

Protein Analysis

62

Amino Acids

7.16

Weight (kDa)

8.12

Isoelectric Point (pI)

60.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GSH_synth_ATP PF03917 2 - 60 2.4e-14 Eukaryotic glutathione synthase, ATP binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 122
AgsI TTSAA 1 cut(s) 25
AlwI GGATC 1 cut(s) 122
BcgI CGANNNNNNTGC 2 cut(s) 76, 110
BciVI GTATCC 1 cut(s) 76
BfaI CTAG 3 cut(s) 141, 149, 170
BfmI CTRYAG 1 cut(s) 95
BfuI GTATCC 1 cut(s) 76
BmiI GGNNCC 1 cut(s) 45
BmsI GCATC 1 cut(s) 156
Bsp143I GATC 2 cut(s) 67, 127
BspLI GGNNCC 1 cut(s) 45
BspMAI CTGCAG 1 cut(s) 99
BspPI GGATC 1 cut(s) 122
BssMI GATC 2 cut(s) 67, 127
Bst4CI ACNGT 1 cut(s) 108
BstKTI GATC 2 cut(s) 70, 130
BstMBI GATC 2 cut(s) 67, 127
BstSFI CTRYAG 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BsuI GTATCC 1 cut(s) 76
BtsIMutI CAGTG 1 cut(s) 104
CviAII CATG 1 cut(s) 158
CviJI RGCY 1 cut(s) 44
CviKI_1 RGCY 1 cut(s) 44
DpnI GATC 2 cut(s) 69, 129
DpnII GATC 2 cut(s) 67, 127
FaeI CATG 1 cut(s) 161
FaiI YATR 2 cut(s) 50, 159
FatI CATG 1 cut(s) 157
FspBI CTAG 3 cut(s) 141, 149, 170
Hin1II CATG 1 cut(s) 161
HinfI GANTC 2 cut(s) 90, 101
Hpy188III TCNNGA 4 cut(s) 11, 111, 141, 149
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 97
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 2 cut(s) 67, 127
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 4 cut(s) 24, 83, 107, 124
LweI GCATC 1 cut(s) 156
MaeI CTAG 3 cut(s) 141, 149, 170
MalI GATC 2 cut(s) 69, 129
MboI GATC 2 cut(s) 67, 127
MflI RGATCY 1 cut(s) 127
MseI TTAA 1 cut(s) 54
NdeII GATC 2 cut(s) 67, 127
NlaIII CATG 1 cut(s) 161
NlaIV GGNNCC 1 cut(s) 45
PfeI GAWTC 2 cut(s) 90, 101
PspN4I GGNNCC 1 cut(s) 45
PstI CTGCAG 1 cut(s) 99
PsuI RGATCY 1 cut(s) 127
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 2 cut(s) 67, 127
SbfI CCTGCAGG 1 cut(s) 99
SdaI CCTGCAGG 1 cut(s) 99
SfaNI GCATC 1 cut(s) 156
SfcI CTRYAG 1 cut(s) 95
Sse8387I CCTGCAGG 1 cut(s) 99
SspMI CTAG 3 cut(s) 141, 149, 170
TaaI ACNGT 1 cut(s) 108
TaqI TCGA 1 cut(s) 70
TfiI GAWTC 2 cut(s) 90, 101
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 1 cut(s) 111
TspDTI ATGAA 2 cut(s) 72, 146
TspRI CASTG 1 cut(s) 111
XbaI TCTAGA 2 cut(s) 140, 148
XspI CTAG 3 cut(s) 141, 149, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.