Rorug03G0134200

Syntaxin 6, N-terminal

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0004239
Physical Location & Seq
Reverse (-)
10991813 .. 10993451
1639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0134200.1

Sequence Viewer

Length: 354 bp
ATGGGAAGGAAGAAGATTACTAGTGATAATAGCACAGAGACCATCAACCTTGAAAATGGGCAAACTGGAACTAAATCTACTAGCTGGAATTCTCAAACAGTAGCTATATTTTGTGACTTATGTATCAAGGAAGTTGGAAAAGGACAAAGGCCTGGTACTCACTTTAATAAAGAAGGATGGGCTAGTTTGGTTGCAAACTTTCATGCAGAGACAGGAAATAATTATGACAAATCACAATTGAAGAACAAGTGGGATTTACTGAAAAAAGAATGGAAAATATGGAAAGATCTAATCGGAAAGGATACTGGCCTTGGTTGGAATCCCACTAAAAATACTGTCGATGCATCCGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Syntaxin-6_N

Protein Analysis

117

Amino Acids

13.13

Weight (kDa)

8.89

Isoelectric Point (pI)

8.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-bind_3 PF12776 28 - 117 1.3e-24 Myb/SANT-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 88
AfaI GTAC 1 cut(s) 157
AgsI TTSAA 2 cut(s) 53, 241
AhlI ACTAGT 1 cut(s) 20
AjnI CCWGG 1 cut(s) 151
AluBI AGCT 2 cut(s) 84, 104
AluI AGCT 2 cut(s) 84, 104
Alw26I GTCTC 2 cut(s) 32, 203
AoxI GGCC 2 cut(s) 149, 307
ApoI RAATTY 1 cut(s) 88
BaeI ACNNNNGTAYC 2 cut(s) 106, 139
BccI CCATC 2 cut(s) 50, 171
BciT130I CCWGG 1 cut(s) 153
BciVI GTATCC 1 cut(s) 295
BcoDI GTCTC 2 cut(s) 32, 203
BcuI ACTAGT 1 cut(s) 20
BfaI CTAG 3 cut(s) 21, 81, 183
BfuI GTATCC 1 cut(s) 295
BglII AGATCT 1 cut(s) 286
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BmsI GCATC 1 cut(s) 331
BsaI GGTCTC 1 cut(s) 32
BsaJI CCNNGG 1 cut(s) 310
Bse1I ACTGG 2 cut(s) 70, 310
BseBI CCWGG 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 310
BseGI GGATG 2 cut(s) 182, 344
BseNI ACTGG 2 cut(s) 70, 310
BshFI GGCC 2 cut(s) 151, 309
BsmAI GTCTC 2 cut(s) 32, 203
BsnI GGCC 2 cut(s) 151, 309
Bso31I GGTCTC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 286
BspANI GGCC 2 cut(s) 151, 309
BspTNI GGTCTC 1 cut(s) 32
BsrI ACTGG 2 cut(s) 70, 310
BssECI CCNNGG 1 cut(s) 310
BssMI GATC 1 cut(s) 286
BssT1I CCWWGG 1 cut(s) 310
Bst2UI CCWGG 1 cut(s) 153
Bst4CI ACNGT 2 cut(s) 100, 337
BstF5I GGATG 2 cut(s) 182, 344
BstKTI GATC 1 cut(s) 289
BstMAI GTCTC 2 cut(s) 32, 203
BstMBI GATC 1 cut(s) 286
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
BstX2I RGATCY 1 cut(s) 286
BstYI RGATCY 1 cut(s) 286
BsuI GTATCC 1 cut(s) 295
BsuRI GGCC 2 cut(s) 151, 309
BtsCI GGATG 2 cut(s) 182, 344
Csp6I GTAC 1 cut(s) 156
CviAII CATG 1 cut(s) 203
CviJI RGCY 5 cut(s) 84, 104, 151, 182, 309
CviKI_1 RGCY 5 cut(s) 84, 104, 151, 182, 309
CviQI GTAC 1 cut(s) 156
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 310
Eco147I AGGCCT 1 cut(s) 151
Eco31I GGTCTC 1 cut(s) 32
EcoRI GAATTC 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 151
EcoT14I CCWWGG 1 cut(s) 310
EcoT22I ATGCAT 1 cut(s) 346
ErhI CCWWGG 1 cut(s) 310
FaeI CATG 1 cut(s) 206
FaiI YATR 5 cut(s) 107, 121, 204, 225, 280
FatI CATG 1 cut(s) 202
FokI GGATG 2 cut(s) 189, 331
FspBI CTAG 3 cut(s) 21, 81, 183
HaeIII GGCC 2 cut(s) 151, 309
Hin1II CATG 1 cut(s) 206
HinfI GANTC 1 cut(s) 319
Hpy188I TCNGA 2 cut(s) 296, 349
HpyAV CCTTC 1 cut(s) 167
HpyCH4III ACNGT 2 cut(s) 100, 337
HpyCH4V TGCA 3 cut(s) 194, 206, 344
Hsp92II CATG 1 cut(s) 206
Kzo9I GATC 1 cut(s) 286
LpnPI CCDG 6 cut(s) 51, 70, 138, 165, 198, 291
LweI GCATC 1 cut(s) 331
MaeI CTAG 3 cut(s) 21, 81, 183
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 3 cut(s) 22, 25, 253
MfeI CAATTG 1 cut(s) 236
MflI RGATCY 1 cut(s) 286
MluCI AATT 3 cut(s) 88, 220, 236
MmeI TCCRAC 2 cut(s) 115, 296
Mph1103I ATGCAT 1 cut(s) 346
MseI TTAA 1 cut(s) 165
MspR9I CCNGG 1 cut(s) 153
MunI CAATTG 1 cut(s) 236
MvaI CCWGG 1 cut(s) 153
NdeII GATC 1 cut(s) 286
NlaIII CATG 1 cut(s) 206
NmuCI GTSAC 1 cut(s) 113
NsiI ATGCAT 1 cut(s) 346
PceI AGGCCT 1 cut(s) 151
PcsI WCGNNNNNNNCGW 1 cut(s) 345
PfeI GAWTC 1 cut(s) 319
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
PsrI GAACNNNNNNTAC 2 cut(s) 61, 93
PsuI RGATCY 1 cut(s) 286
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
SaqAI TTAA 1 cut(s) 165
Sau3AI GATC 1 cut(s) 286
ScrFI CCNGG 1 cut(s) 153
SetI ASST 3 cut(s) 51, 86, 106
SfaNI GCATC 1 cut(s) 331
SpeI ACTAGT 1 cut(s) 20
Sse9I AATT 3 cut(s) 88, 220, 236
SseBI AGGCCT 1 cut(s) 151
SspMI CTAG 3 cut(s) 21, 81, 183
StuI AGGCCT 1 cut(s) 151
StyD4I CCNGG 1 cut(s) 151
StyI CCWWGG 1 cut(s) 310
TaaI ACNGT 2 cut(s) 100, 337
TaqI TCGA 1 cut(s) 339
TasI AATT 3 cut(s) 88, 220, 236
TfiI GAWTC 1 cut(s) 319
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 191
XapI RAATTY 1 cut(s) 88
XspI CTAG 3 cut(s) 21, 81, 183
Zsp2I ATGCAT 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.