Rorug03G0167600

Histone-lysine N-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
14003289 .. 14003698
410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0167600.1

Sequence Viewer

Length: 156 bp
ATGGTTTTCAACAGAAAGGTGCTCTTGAAGTTCCATGCAGACCTGAGGATTTGCATAAGATTCTGGAGAACAGGAGGGAGAAGAGTAGGACTAGTGCTACATGTAAATTGTAATAATACTAATAGTAATATCCCTACCCTTATAGAAGGATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.96

Weight (kDa)

10.85

Isoelectric Point (pI)

28.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 100
AgsI TTSAA 2 cut(s) 10, 28
AhlI ACTAGT 1 cut(s) 91
Alw21I GWGCWC 1 cut(s) 24
AxyI CCTNAGG 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 24
BciVI GTATCC 1 cut(s) 143
BcuI ACTAGT 1 cut(s) 91
BfaI CTAG 2 cut(s) 92, 154
BfuI GTATCC 1 cut(s) 143
BpmI CTGGAG 1 cut(s) 85
Bse21I CCTNAGG 1 cut(s) 44
BseMII CTCAG 1 cut(s) 35
BsiHKAI GWGCWC 1 cut(s) 24
Bsp1286I GDGCHC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 36
Bst6I CTCTTC 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 104
Bsu36I CCTNAGG 1 cut(s) 44
BsuI GTATCC 1 cut(s) 143
CviAII CATG 2 cut(s) 35, 101
DdeI CTNAG 1 cut(s) 44
Eam1104I CTCTTC 1 cut(s) 76
EarI CTCTTC 1 cut(s) 76
Eco81I CCTNAGG 1 cut(s) 44
FaeI CATG 2 cut(s) 38, 104
FaiI YATR 4 cut(s) 36, 56, 102, 143
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FatI CATG 2 cut(s) 34, 100
FspBI CTAG 2 cut(s) 92, 154
GsuI CTGGAG 1 cut(s) 85
Hin1II CATG 2 cut(s) 38, 104
HinfI GANTC 1 cut(s) 60
Hpy188III TCNNGA 2 cut(s) 25, 64
HpyAV CCTTC 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 38, 54
HpyF3I CTNAG 1 cut(s) 44
Hsp92II CATG 2 cut(s) 38, 104
LpnPI CCDG 3 cut(s) 49, 56, 57
MaeI CTAG 2 cut(s) 92, 154
MboII GAAGA 1 cut(s) 93
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 1 cut(s) 106
MnlI CCTC 2 cut(s) 39, 68
NlaIII CATG 2 cut(s) 38, 104
NspI RCATGY 1 cut(s) 104
PciI ACATGT 1 cut(s) 100
PfeI GAWTC 1 cut(s) 60
PscI ACATGT 1 cut(s) 100
SduI GDGCHC 1 cut(s) 24
SetI ASST 2 cut(s) 21, 45
SgeI CNNG 7 cut(s) 37, 47, 55, 76, 84, 104, 113
SpeI ACTAGT 1 cut(s) 91
Sse9I AATT 1 cut(s) 106
SspMI CTAG 2 cut(s) 92, 154
TasI AATT 1 cut(s) 106
TfiI GAWTC 1 cut(s) 60
XceI RCATGY 1 cut(s) 104
XspI CTAG 2 cut(s) 92, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.