Rorug03G0208000

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
18507228 .. 18507488
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0208000.1

Sequence Viewer

Length: 261 bp
ATGAAAAGGAGAACAGATAAGTCGAAGGAAAATTTTTCGGAGGTAAGTCGAGTTTTAGATGATTGTAAAGATTATCTTTCTTCTTTTCAATCATGTAGAATAAGACATATCTTCCATGAAGCAAATGGTGTTGCACATAGGCTTGCACACCTTGCTAGTGTTGCTAGGCTGGATGATGTATGGTTAGAGGAGACTCCTGCTATTATTCAGGATGTACTCTACGAGGATTATTGTAATCTTTCTAATGTAGCACGGGGTTAA

Protein Analysis

86

Amino Acids

9.95

Weight (kDa)

6.04

Isoelectric Point (pI)

46.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 7 - 51 3.3e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 31
AfaI GTAC 1 cut(s) 216
AgsI TTSAA 1 cut(s) 89
Alw26I GTCTC 1 cut(s) 185
ApoI RAATTY 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 185
BfaI CTAG 2 cut(s) 156, 165
BseGI GGATG 2 cut(s) 178, 217
BseRI GAGGAG 1 cut(s) 203
BsmAI GTCTC 1 cut(s) 185
BstAPI GCANNNNNTGC 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 144
BstF5I GGATG 2 cut(s) 178, 217
BstMAI GTCTC 1 cut(s) 185
BstMWI GCNNNNNNNGC 2 cut(s) 152, 161
BtsCI GGATG 2 cut(s) 178, 217
Cac8I GCNNGC 1 cut(s) 144
Csp6I GTAC 1 cut(s) 215
CviAII CATG 2 cut(s) 93, 116
CviJI RGCY 2 cut(s) 142, 169
CviKI_1 RGCY 2 cut(s) 142, 169
CviQI GTAC 1 cut(s) 215
FaeI CATG 2 cut(s) 96, 119
FaiI YATR 5 cut(s) 94, 108, 117, 138, 181
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FatI CATG 2 cut(s) 92, 115
FokI GGATG 2 cut(s) 185, 224
FspBI CTAG 2 cut(s) 156, 165
Hin1II CATG 2 cut(s) 96, 119
HinfI GANTC 1 cut(s) 193
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 209
HpyAV CCTTC 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 134, 146
HpyF10VI GCNNNNNNNGC 2 cut(s) 152, 161
Hsp92II CATG 2 cut(s) 96, 119
LpnPI CCDG 3 cut(s) 155, 194, 210
MaeI CTAG 2 cut(s) 156, 165
MboII GAAGA 2 cut(s) 72, 103
MluCI AATT 1 cut(s) 31
MlyI GAGTC 1 cut(s) 187
MnlI CCTC 3 cut(s) 34, 181, 217
MseI TTAA 1 cut(s) 259
MwoI GCNNNNNNNGC 2 cut(s) 152, 161
NlaIII CATG 2 cut(s) 96, 119
PleI GAGTC 1 cut(s) 187
PpsI GAGTC 1 cut(s) 187
RsaI GTAC 1 cut(s) 216
RsaNI GTAC 1 cut(s) 215
SaqAI TTAA 1 cut(s) 259
SchI GAGTC 1 cut(s) 187
SetI ASST 2 cut(s) 45, 153
Sse9I AATT 1 cut(s) 31
SspMI CTAG 2 cut(s) 156, 165
TaqI TCGA 2 cut(s) 23, 49
TasI AATT 1 cut(s) 31
TatI WGTACW 1 cut(s) 214
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TspDTI ATGAA 2 cut(s) 17, 132
XapI RAATTY 1 cut(s) 31
XcmI CCANNNNNNNNNTGG 1 cut(s) 122
XspI CTAG 2 cut(s) 156, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.