Rorug03G0288900

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
29358177 .. 29360051
1875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0288900.1

Sequence Viewer

Length: 366 bp
ATGGGTAGAACAAAATCATTCAAGGACGAGCTTACATTCGAGCAAAGGGTGCAAGAATCGCGGGATGTTCAGGCCAAATACCCTGATCGAGTTCCGGTAATTGTTGAAAAGTATGCCAAGTGCGACCTTCCTCAGATGGAAAAGAGAAGATATCTTGTCCCCCGGGACATGTCTGTCGGGCAATTCATTTACACTTTGAGCGAGAGACTTCATCTGGCCCCTGGAAAAGCGCTCTTCGTATTTGTAAAGGATACTTTACCCCCAATAGCTAGTATGATGAACTTTGTCTATGAATCCTACAAGGACGAGGATGGATTTCTATACATGTGTTATAGCACCGAGAAAACCTTTGGTCATGCTAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

14.18

Weight (kDa)

7.73

Isoelectric Point (pI)

45.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATG8 PF02991 15 - 118 4.3e-42 Autophagy protein Atg8 ubiquitin like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009971)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 173
AccII CGCG 1 cut(s) 61
AciI CCGC 1 cut(s) 61
AfeI AGCGCT 1 cut(s) 231
AflIII ACRYGT 2 cut(s) 168, 324
AgsI TTSAA 2 cut(s) 22, 107
AjnI CCWGG 1 cut(s) 220
AluBI AGCT 3 cut(s) 31, 269, 363
AluI AGCT 3 cut(s) 31, 269, 363
Alw26I GTCTC 1 cut(s) 199
Ama87I CYCGRG 1 cut(s) 162
Aor51HI AGCGCT 1 cut(s) 231
AoxI GGCC 2 cut(s) 72, 216
AspLEI GCGC 1 cut(s) 232
AspS9I GGNCC 1 cut(s) 217
AsuC2I CCSGG 2 cut(s) 163, 164
AsuNHI GCTAGC 1 cut(s) 359
AvaI CYCGRG 1 cut(s) 162
BccI CCATC 2 cut(s) 130, 305
BciT130I CCWGG 1 cut(s) 222
BciVI GTATCC 1 cut(s) 244
BcnI CCSGG 2 cut(s) 163, 164
BcoDI GTCTC 1 cut(s) 199
BfaI CTAG 2 cut(s) 270, 360
BfoI RGCGCY 1 cut(s) 233
BfuI GTATCC 1 cut(s) 244
Bme1390I CCNGG 3 cut(s) 163, 164, 222
BmeT110I CYCGRG 1 cut(s) 162
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 1 cut(s) 219
BmrFI CCNGG 3 cut(s) 163, 164, 222
BmtI GCTAGC 1 cut(s) 363
BpuMI CCSGG 2 cut(s) 163, 164
BsaJI CCNNGG 3 cut(s) 161, 162, 220
BsaWI WCCGGW 1 cut(s) 94
BseBI CCWGG 1 cut(s) 222
BseDI CCNNGG 3 cut(s) 161, 162, 220
BseGI GGATG 2 cut(s) 70, 316
BseMII CTCAG 1 cut(s) 146
Bsh1236I CGCG 1 cut(s) 61
BshFI GGCC 2 cut(s) 74, 218
BsiHKCI CYCGRG 1 cut(s) 162
BsiSI CCGG 2 cut(s) 95, 163
BslFI GGGAC 2 cut(s) 143, 179
BsmAI GTCTC 1 cut(s) 199
BsmFI GGGAC 2 cut(s) 143, 179
BsnI GGCC 2 cut(s) 74, 218
BsoBI CYCGRG 1 cut(s) 162
Bsp143I GATC 1 cut(s) 85
BspACI CCGC 1 cut(s) 61
BspANI GGCC 2 cut(s) 74, 218
BspCNI CTCAG 1 cut(s) 145
BspFNI CGCG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 219
BspOI GCTAGC 1 cut(s) 363
BspQI GCTCTTC 1 cut(s) 239
BssECI CCNNGG 3 cut(s) 161, 162, 220
BssMI GATC 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 222
Bst6I CTCTTC 1 cut(s) 239
BstAPI GCANNNNNTGC 1 cut(s) 49
BstC8I GCNNGC 1 cut(s) 361
BstDEI CTNAG 1 cut(s) 132
BstF5I GGATG 2 cut(s) 70, 316
BstFNI CGCG 1 cut(s) 61
BstH2I RGCGCY 1 cut(s) 233
BstHHI GCGC 1 cut(s) 232
BstKTI GATC 1 cut(s) 88
BstMAI GTCTC 1 cut(s) 199
BstMBI GATC 1 cut(s) 85
BstMWI GCNNNNNNNGC 2 cut(s) 49, 58
BstNI CCWGG 1 cut(s) 222
BstNSI RCATGY 2 cut(s) 172, 328
BstSCI CCNGG 3 cut(s) 161, 162, 220
BstUI CGCG 1 cut(s) 61
BsuI GTATCC 1 cut(s) 244
BsuRI GGCC 2 cut(s) 74, 218
BtsCI GGATG 2 cut(s) 70, 316
Cac8I GCNNGC 1 cut(s) 361
CfoI GCGC 1 cut(s) 232
Cfr13I GGNCC 1 cut(s) 217
Cfr9I CCCGGG 1 cut(s) 162
CviAII CATG 3 cut(s) 169, 325, 356
CviJI RGCY 5 cut(s) 31, 74, 218, 269, 363
CviKI_1 RGCY 5 cut(s) 31, 74, 218, 269, 363
DdeI CTNAG 1 cut(s) 132
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
DrdI GACNNNNNNGTC 1 cut(s) 173
DseDI GACNNNNNNGTC 1 cut(s) 173
Eam1104I CTCTTC 1 cut(s) 239
EarI CTCTTC 1 cut(s) 239
Eco32I GATATC 1 cut(s) 152
Eco47III AGCGCT 1 cut(s) 231
Eco88I CYCGRG 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 220
EcoRV GATATC 1 cut(s) 152
FaeI CATG 3 cut(s) 172, 328, 359
FaiI YATR 8 cut(s) 114, 170, 275, 291, 322, 326, 333, 357
FaqI GGGAC 2 cut(s) 143, 179
FatI CATG 3 cut(s) 168, 324, 355
FauI CCCGC 1 cut(s) 54
FokI GGATG 2 cut(s) 77, 323
FspBI CTAG 2 cut(s) 270, 360
GlaI GCGC 1 cut(s) 231
HaeII RGCGCY 1 cut(s) 233
HaeIII GGCC 2 cut(s) 74, 218
HapII CCGG 2 cut(s) 95, 163
HhaI GCGC 1 cut(s) 232
Hin1II CATG 3 cut(s) 172, 328, 359
Hin6I GCGC 1 cut(s) 230
HinP1I GCGC 1 cut(s) 230
HinfI GANTC 2 cut(s) 56, 293
HpaII CCGG 2 cut(s) 95, 163
Hpy188I TCNGA 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 58
HpyF3I CTNAG 1 cut(s) 132
Hsp92II CATG 3 cut(s) 172, 328, 359
HspAI GCGC 1 cut(s) 230
Kzo9I GATC 1 cut(s) 85
LguI GCTCTTC 1 cut(s) 239
LpnPI CCDG 7 cut(s) 56, 96, 108, 176, 200, 207, 234
MaeI CTAG 2 cut(s) 270, 360
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 2 cut(s) 159, 226
MluCI AATT 2 cut(s) 99, 182
MnlI CCTC 2 cut(s) 141, 301
MspI CCGG 2 cut(s) 95, 163
MspR9I CCNGG 3 cut(s) 163, 164, 222
MvaI CCWGG 1 cut(s) 222
MvnI CGCG 1 cut(s) 61
MwoI GCNNNNNNNGC 2 cut(s) 49, 58
NciI CCSGG 2 cut(s) 163, 164
NdeII GATC 1 cut(s) 85
NheI GCTAGC 1 cut(s) 359
NlaIII CATG 3 cut(s) 172, 328, 359
NlaIV GGNNCC 1 cut(s) 219
NspI RCATGY 2 cut(s) 172, 328
PciI ACATGT 2 cut(s) 168, 324
PciSI GCTCTTC 1 cut(s) 239
PfeI GAWTC 2 cut(s) 56, 293
PscI ACATGT 2 cut(s) 168, 324
Psp6I CCWGG 1 cut(s) 220
PspGI CCWGG 1 cut(s) 220
PspN4I GGNNCC 1 cut(s) 219
PspPI GGNCC 1 cut(s) 217
SapI GCTCTTC 1 cut(s) 239
Sau3AI GATC 1 cut(s) 85
Sau96I GGNCC 1 cut(s) 217
ScrFI CCNGG 3 cut(s) 163, 164, 222
SetI ASST 5 cut(s) 33, 129, 271, 350, 365
SmaI CCCGGG 1 cut(s) 164
Sse9I AATT 2 cut(s) 99, 182
SsiI CCGC 1 cut(s) 61
SspMI CTAG 2 cut(s) 270, 360
StyD4I CCNGG 3 cut(s) 161, 162, 220
TaqI TCGA 2 cut(s) 39, 88
TasI AATT 2 cut(s) 99, 182
TfiI GAWTC 2 cut(s) 56, 293
TspDTI ATGAA 4 cut(s) 175, 200, 293, 306
TspMI CCCGGG 1 cut(s) 162
XceI RCATGY 2 cut(s) 172, 328
XmaI CCCGGG 1 cut(s) 162
XspI CTAG 2 cut(s) 270, 360
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.