Rorug03G0311700

Chlorophyllase-2

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
33319307 .. 33320470
1164 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0311700.1

Sequence Viewer

Length: 306 bp
ATGAGAATCTTGGTTACTGGAGGAGCTGGATTCATTGGTTCTCACCTGGTTGACAGATTAATGGAAAATGAAAAGAATGAGGTTATTGTTGTTGATAACTACTTCACTGGCTCCAAGGACAATCTTAAAAAATGGATTGGTCATCCCAGATTTGAGCTTATTCGTCATGATGTCACTGAAACATTGTTGGTTGAGGTTGATCGGATATACCATCTTGCATGCCCAGCTTCTCCAATTTTCTACAAATATAATCCTGTAAAGACAATAAAAACAAATGTGAGGGCAAGCGTGTTGCTGAGACCTTGA

Protein Analysis

101

Amino Acids

11.58

Weight (kDa)

9.17

Isoelectric Point (pI)

23.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Epimerase PF01370 3 - 97 4.2e-13 NAD dependent epimerase/dehydratase family
Polysacc_synt_2 PF02719 3 - 95 9.1e-06 Polysaccharide biosynthesis protein
GDP_Man_Dehyd PF16363 4 - 96 6.5e-13 GDP-mannose 4,6 dehydratase
3Beta_HSD PF01073 4 - 93 6.6e-07 3-beta hydroxysteroid dehydrogenase/isomerase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011927)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 3 cut(s) 26, 157, 227
AluI AGCT 3 cut(s) 26, 157, 227
Alw26I GTCTC 1 cut(s) 292
AseI ATTAAT 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 35
BccI CCATC 1 cut(s) 219
BciT130I CCWGG 1 cut(s) 47
BcoDI GTCTC 1 cut(s) 292
Bme1390I CCNGG 1 cut(s) 47
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 47
BpmI CTGGAG 1 cut(s) 39
BsaI GGTCTC 1 cut(s) 292
BsaJI CCNNGG 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 22, 112
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 1 cut(s) 142
BseMII CTCAG 1 cut(s) 287
BseNI ACTGG 2 cut(s) 22, 112
BseRI GAGGAG 1 cut(s) 36
BseYI CCCAGC 1 cut(s) 223
BsmAI GTCTC 1 cut(s) 292
Bso31I GGTCTC 1 cut(s) 292
Bsp143I GATC 1 cut(s) 199
BspCNI CTCAG 1 cut(s) 288
BspHI TCATGA 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 112
BspTNI GGTCTC 1 cut(s) 292
BsrI ACTGG 2 cut(s) 22, 112
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 1 cut(s) 199
BssT1I CCWWGG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 47
BstC8I GCNNGC 2 cut(s) 220, 286
BstDEI CTNAG 1 cut(s) 296
BstF5I GGATG 1 cut(s) 142
BstKTI GATC 1 cut(s) 202
BstMAI GTCTC 1 cut(s) 292
BstMBI GATC 1 cut(s) 199
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 45
BtsCI GGATG 1 cut(s) 142
BtsIMutI CAGTG 2 cut(s) 105, 174
Cac8I GCNNGC 2 cut(s) 220, 286
CciI TCATGA 1 cut(s) 166
CsiI ACCWGGT 1 cut(s) 45
CviAII CATG 2 cut(s) 167, 219
CviJI RGCY 4 cut(s) 26, 111, 157, 227
CviKI_1 RGCY 4 cut(s) 26, 111, 157, 227
DdeI CTNAG 1 cut(s) 296
DpnI GATC 1 cut(s) 201
DpnII GATC 1 cut(s) 199
Eco130I CCWWGG 1 cut(s) 114
Eco31I GGTCTC 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 2 cut(s) 170, 222
FaiI YATR 4 cut(s) 168, 208, 220, 249
FatI CATG 2 cut(s) 166, 218
FokI GGATG 1 cut(s) 129
GsaI CCCAGC 1 cut(s) 227
GsuI CTGGAG 1 cut(s) 39
Hin1II CATG 2 cut(s) 170, 222
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 2 cut(s) 6, 30
HphI GGTGA 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 1 cut(s) 296
Hsp92II CATG 2 cut(s) 170, 222
Kzo9I GATC 1 cut(s) 199
LmnI GCTCC 2 cut(s) 23, 116
LpnPI CCDG 8 cut(s) 3, 12, 32, 59, 93, 160, 237, 267
MabI ACCWGGT 1 cut(s) 45
MaeIII GTNAC 2 cut(s) 13, 172
MalI GATC 1 cut(s) 201
MboI GATC 1 cut(s) 199
MluCI AATT 1 cut(s) 234
MnlI CCTC 4 cut(s) 14, 73, 187, 273
MseI TTAA 2 cut(s) 59, 126
MspR9I CCNGG 1 cut(s) 47
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 1 cut(s) 199
NlaIII CATG 2 cut(s) 170, 222
NlaIV GGNNCC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 172
NspI RCATGY 1 cut(s) 222
PaeI GCATGC 1 cut(s) 222
PagI TCATGA 1 cut(s) 166
PfeI GAWTC 2 cut(s) 6, 30
PshBI ATTAAT 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 223
PspGI CCWGG 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 112
SaqAI TTAA 2 cut(s) 59, 126
Sau3AI GATC 1 cut(s) 199
ScrFI CCNGG 1 cut(s) 47
SetI ASST 7 cut(s) 28, 48, 84, 159, 198, 229, 304
SexAI ACCWGGT 1 cut(s) 45
SphI GCATGC 1 cut(s) 222
Sse9I AATT 1 cut(s) 234
StyD4I CCNGG 1 cut(s) 45
StyI CCWWGG 1 cut(s) 114
TasI AATT 1 cut(s) 234
TfiI GAWTC 2 cut(s) 6, 30
Tru1I TTAA 2 cut(s) 59, 126
Tru9I TTAA 2 cut(s) 59, 126
TscAI CASTG 2 cut(s) 112, 181
TseFI GTSAC 1 cut(s) 172
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 2 cut(s) 22, 84
TspRI CASTG 2 cut(s) 112, 181
VspI ATTAAT 1 cut(s) 59
XceI RCATGY 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.