Rorug04G0169200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0016307
Physical Location & Seq
Reverse (-)
29829542 .. 29829757
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0169200.1

Sequence Viewer

Length: 216 bp
ATGTCGTATCAACGGCATCGAAGATTCTTACCACGTCACCATCCTTATTTTAGGCAAGAAGTAGCTTTCGATAACACTGAAGAAGCTGACCTCGCTCATGTTCCATTAAGTGGACAGGAAGTGTTGGAAAGAGTGGAAGGGTTGAACATGCCTTTTGGTAAAAAGCATCGTCATCCTTCATATAAGGGTGTTGAAGATTTGAACAGGCCATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.46

Weight (kDa)

8.0

Isoelectric Point (pI)

62.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transposase_21 PF02992 1 - 46 2.8e-06 Transposase family tnp2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016307)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g17371
malus_domestica MD13G1172700.v1.1 MD16G1174200.v1.1
prunus_persica Prupe.1G140900_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0421301
rosa_laevigata RLG00000007699
rosa_multiflora Rmu_sc0004892.1_g000010 Rmu_sc0007721.1_g000001
rosa_roxburghii Rroxscaffold_5G00363530
rosa_rugosa Rorug04G0169200
rosa_samantha Rh4AG230600 Rh4BG233600 Rh4CG244800 Rh4DG229300
rosa_wichuraiana Rw4G020320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 110
AcuI CTGAAG 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 3 cut(s) 145, 194, 202
AjiI CACGTC 1 cut(s) 35
AluBI AGCT 2 cut(s) 65, 86
AluI AGCT 2 cut(s) 65, 86
AoxI GGCC 1 cut(s) 206
AsuHPI GGTGA 1 cut(s) 29
BccI CCATC 1 cut(s) 48
BceAI ACGGC 1 cut(s) 29
BmgBI CACGTC 1 cut(s) 35
BmsI GCATC 2 cut(s) 25, 175
Bsc4I CCNNNNNNNGG 1 cut(s) 110
BseGI GGATG 2 cut(s) 40, 172
BseLI CCNNNNNNNGG 1 cut(s) 110
BshFI GGCC 1 cut(s) 208
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 1 cut(s) 208
BspANI GGCC 1 cut(s) 208
BstF5I GGATG 2 cut(s) 40, 172
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 151
BsuRI GGCC 1 cut(s) 208
BtrI CACGTC 1 cut(s) 35
BtsCI GGATG 2 cut(s) 40, 172
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 3 cut(s) 98, 148, 210
CviJI RGCY 3 cut(s) 65, 86, 208
CviKI_1 RGCY 3 cut(s) 65, 86, 208
Eco57I CTGAAG 1 cut(s) 99
FaeI CATG 3 cut(s) 101, 151, 213
FaiI YATR 5 cut(s) 99, 149, 181, 183, 211
FatI CATG 3 cut(s) 97, 147, 209
FokI GGATG 2 cut(s) 27, 159
HaeIII GGCC 1 cut(s) 208
Hin1II CATG 3 cut(s) 101, 151, 213
HinfI GANTC 1 cut(s) 24
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 113
HpyAV CCTTC 2 cut(s) 131, 186
HpyCH4IV ACGT 1 cut(s) 34
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpySE526I ACGT 1 cut(s) 34
Hsp92II CATG 3 cut(s) 101, 151, 213
LpnPI CCDG 2 cut(s) 101, 190
LweI GCATC 2 cut(s) 25, 175
MaeII ACGT 1 cut(s) 34
MaeIII GTNAC 1 cut(s) 35
MboII GAAGA 3 cut(s) 33, 92, 206
MmeI TCCRAC 1 cut(s) 105
MnlI CCTC 1 cut(s) 101
MseI TTAA 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 92
NlaIII CATG 3 cut(s) 101, 151, 213
NmuCI GTSAC 1 cut(s) 35
NspI RCATGY 1 cut(s) 151
PfeI GAWTC 1 cut(s) 24
PflMI CCANNNNNTGG 1 cut(s) 110
SaqAI TTAA 1 cut(s) 107
SetI ASST 4 cut(s) 37, 67, 88, 93
SfaNI GCATC 2 cut(s) 25, 175
SgeI CNNG 6 cut(s) 45, 68, 104, 110, 128, 160
TaiI ACGT 1 cut(s) 37
TaqI TCGA 2 cut(s) 19, 69
TfiI GAWTC 1 cut(s) 24
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 35
Tsp45I GTSAC 1 cut(s) 35
TspDTI ATGAA 1 cut(s) 168
TspRI CASTG 1 cut(s) 82
Van91I CCANNNNNTGG 1 cut(s) 110
XceI RCATGY 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.