Rorug04G0238100

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
40454637 .. 40454945
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0238100.1

Sequence Viewer

Length: 309 bp
ATGCTTCGGAAAGTTGTATTTGTAATGATAATGATCATGATCCTCACCTTAGCGGCTGGCGTTGGTGGACGAGGACATGCTAGTGGAGGAGGACATTCGAGCAGAGGTGGTAGAGGACATGGTGGCGATGGTGAACATGGCGGCAATGGTGGACATGGTTTTCCTCATATTGGTGGAAGAACTGCTCATCACCATAATCGTACAGAGAAAAGCGGTTCATCCGATAGCTTGATGTCTTCATACTCTCTTGGTTCAGTTGTGCTTTGCTTGACCTTGCACTACTTGCGTGCTGTGGTCGAAGCCCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

10.47

Weight (kDa)

10.01

Isoelectric Point (pI)

45.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 53, 141, 213
AclWI GGATC 1 cut(s) 34
AfaI GTAC 1 cut(s) 202
AfiI CCNNNNNNNGG 1 cut(s) 170
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
AlwI GGATC 1 cut(s) 34
AsuHPI GGTGA 3 cut(s) 37, 143, 182
BbsI GAAGAC 1 cut(s) 228
BccI CCATC 1 cut(s) 122
BclI TGATCA 1 cut(s) 33
BfaI CTAG 1 cut(s) 81
BisI GCNGC 2 cut(s) 54, 142
BlsI GCNGC 2 cut(s) 55, 143
BpiI GAAGAC 1 cut(s) 228
Bpu10I CCTNAGC 1 cut(s) 49
BsaBI GATNNNNATC 2 cut(s) 32, 38
Bsc4I CCNNNNNNNGG 1 cut(s) 170
Bse3DI GCAATG 1 cut(s) 151
Bse8I GATNNNNATC 2 cut(s) 32, 38
BseGI GGATG 1 cut(s) 218
BseJI GATNNNNATC 2 cut(s) 32, 38
BseLI CCNNNNNNNGG 1 cut(s) 170
BseMI GCAATG 1 cut(s) 151
BseRI GAGGAG 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 170
Bsp143I GATC 2 cut(s) 33, 39
BspACI CCGC 3 cut(s) 53, 141, 213
BspHI TCATGA 1 cut(s) 36
BspPI GGATC 1 cut(s) 34
BsrDI GCAATG 1 cut(s) 151
BssMI GATC 2 cut(s) 33, 39
BstAPI GCANNNNNTGC 1 cut(s) 283
BstC8I GCNNGC 2 cut(s) 58, 288
BstDEI CTNAG 1 cut(s) 49
BstF5I GGATG 1 cut(s) 218
BstKTI GATC 2 cut(s) 36, 42
BstMBI GATC 2 cut(s) 33, 39
BstMWI GCNNNNNNNGC 1 cut(s) 283
BstNSI RCATGY 1 cut(s) 80
BstV2I GAAGAC 1 cut(s) 228
BtgZI GCGATG 1 cut(s) 141
BtsCI GGATG 1 cut(s) 218
Cac8I GCNNGC 2 cut(s) 58, 288
CciI TCATGA 1 cut(s) 36
Csp6I GTAC 1 cut(s) 201
CviAII CATG 5 cut(s) 37, 77, 119, 137, 155
CviJI RGCY 3 cut(s) 56, 228, 302
CviKI_1 RGCY 3 cut(s) 56, 228, 302
CviQI GTAC 1 cut(s) 201
DdeI CTNAG 1 cut(s) 49
DpnI GATC 2 cut(s) 35, 41
DpnII GATC 2 cut(s) 33, 39
FaeI CATG 5 cut(s) 40, 80, 122, 140, 158
FaiI YATR 8 cut(s) 38, 78, 120, 138, 156, 168, 195, 241
FatI CATG 5 cut(s) 36, 76, 118, 136, 154
FbaI TGATCA 1 cut(s) 33
Fnu4HI GCNGC 2 cut(s) 54, 142
FokI GGATG 1 cut(s) 205
Fsp4HI GCNGC 2 cut(s) 54, 142
FspBI CTAG 1 cut(s) 81
GluI GCNGC 2 cut(s) 54, 142
Hin1II CATG 5 cut(s) 40, 80, 122, 140, 158
HphI GGTGA 3 cut(s) 37, 143, 182
Hpy166II GTNNAC 3 cut(s) 68, 134, 152
Hpy188I TCNGA 2 cut(s) 9, 223
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 3 cut(s) 68, 134, 152
HpyCH4V TGCA 1 cut(s) 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 283
HpyF3I CTNAG 1 cut(s) 49
Hsp92II CATG 5 cut(s) 40, 80, 122, 140, 158
Ksp22I TGATCA 1 cut(s) 33
Kzo9I GATC 2 cut(s) 33, 39
LpnPI CCDG 1 cut(s) 42
MaeI CTAG 1 cut(s) 81
MalI GATC 2 cut(s) 35, 41
MboI GATC 2 cut(s) 33, 39
MboII GAAGA 2 cut(s) 189, 228
MnlI CCTC 7 cut(s) 53, 65, 80, 83, 98, 107, 174
MslI CAYNNNNRTG 2 cut(s) 81, 171
MwoI GCNNNNNNNGC 1 cut(s) 283
NdeII GATC 2 cut(s) 33, 39
NlaIII CATG 5 cut(s) 40, 80, 122, 140, 158
NspI RCATGY 1 cut(s) 80
PagI TCATGA 1 cut(s) 36
PkrI GCNGC 2 cut(s) 55, 143
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
RseI CAYNNNNRTG 2 cut(s) 81, 171
SatI GCNGC 2 cut(s) 54, 142
Sau3AI GATC 2 cut(s) 33, 39
SetI ASST 4 cut(s) 50, 109, 230, 275
SmiMI CAYNNNNRTG 2 cut(s) 81, 171
SsiI CCGC 3 cut(s) 53, 141, 213
SspMI CTAG 1 cut(s) 81
TaqI TCGA 2 cut(s) 98, 297
TauI GCSGC 2 cut(s) 56, 144
TspDTI ATGAA 2 cut(s) 207, 228
XceI RCATGY 1 cut(s) 80
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.