Rorug05G0046700

Auxin response factors (ARFs) are transcriptional factors that bind specifically to the DNA sequence 5'-TGTCTC-3' found in the auxin-responsive promoter elements (AuxREs)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
4083597 .. 4084975
1379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0046700.1

Sequence Viewer

Length: 297 bp
ATGTTGGCCACGGATCTGGATTTAGTTGAGGTTAGCATGAACTTTTCGCATGATATGGATAATGGATATGAGAAAATTTGCAGGAGAATGAATCCACCGAGGGTTGTAGTTGATAATGAAGCCTGCAAGAATGCTACGGGGATAAGGTTGGGCTATTGGCCGCTGACACAGTTGATTAGCCTGGTTGGATTGAAACAACAATCTAATTTAAAATATGGTGTAAAAGTTGTGAAGTCAGACGAACAGGTTCATCTTGTTAAACGGATGAGCAAATGCAAGCTGTCCAAACTGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.15

Weight (kDa)

9.27

Isoelectric Point (pI)

20.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 161
AclWI GGATC 1 cut(s) 21
AcoI YGGCCR 2 cut(s) 6, 158
AcsI RAATTY 1 cut(s) 75
AgsI TTSAA 1 cut(s) 193
AjnI CCWGG 1 cut(s) 180
AluBI AGCT 1 cut(s) 280
AluI AGCT 1 cut(s) 280
AlwI GGATC 1 cut(s) 21
AoxI GGCC 2 cut(s) 6, 158
ApoI RAATTY 1 cut(s) 75
Asp700I GAANNNNTTC 1 cut(s) 246
BalI TGGCCA 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 182
BisI GCNGC 1 cut(s) 161
BlsI GCNGC 1 cut(s) 162
Bme1390I CCNGG 1 cut(s) 182
BmrFI CCNGG 1 cut(s) 182
BsaJI CCNNGG 2 cut(s) 9, 98
BseBI CCWGG 1 cut(s) 182
BseDI CCNNGG 2 cut(s) 9, 98
BseGI GGATG 1 cut(s) 270
BshFI GGCC 2 cut(s) 8, 160
BsmI GAATGC 1 cut(s) 136
BsnI GGCC 2 cut(s) 8, 160
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 1 cut(s) 161
BspANI GGCC 2 cut(s) 8, 160
BspPI GGATC 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 9, 98
BssMI GATC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 171
BstC8I GCNNGC 2 cut(s) 124, 278
BstDSI CCRYGG 1 cut(s) 9
BstF5I GGATG 1 cut(s) 270
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstNI CCWGG 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 180
BstX2I RGATCY 1 cut(s) 13
BstXI CCANNNNNNTGG 1 cut(s) 16
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 2 cut(s) 8, 160
BtgI CCRYGG 1 cut(s) 9
BtsCI GGATG 1 cut(s) 270
Cac8I GCNNGC 2 cut(s) 124, 278
CviAII CATG 2 cut(s) 37, 50
CviJI RGCY 6 cut(s) 8, 122, 153, 160, 180, 280
CviKI_1 RGCY 6 cut(s) 8, 122, 153, 160, 180, 280
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
DraI TTTAAA 1 cut(s) 210
EaeI YGGCCR 2 cut(s) 6, 158
EcoRII CCWGG 1 cut(s) 180
FaeI CATG 2 cut(s) 40, 53
FaiI YATR 5 cut(s) 38, 51, 56, 69, 216
FatI CATG 2 cut(s) 36, 49
Fnu4HI GCNGC 1 cut(s) 161
FokI GGATG 1 cut(s) 277
Fsp4HI GCNGC 1 cut(s) 161
GluI GCNGC 1 cut(s) 161
HaeIII GGCC 2 cut(s) 8, 160
Hin1II CATG 2 cut(s) 40, 53
HinfI GANTC 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 238
Hpy188III TCNNGA 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 171
HpyCH4V TGCA 3 cut(s) 81, 126, 276
Hsp92II CATG 2 cut(s) 40, 53
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 6 cut(s) 2, 67, 136, 167, 194, 230
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MflI RGATCY 1 cut(s) 13
MlsI TGGCCA 1 cut(s) 8
MluCI AATT 3 cut(s) 75, 205, 292
MluNI TGGCCA 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 166
MnlI CCTC 2 cut(s) 22, 93
Mox20I TGGCCA 1 cut(s) 8
MroXI GAANNNNTTC 1 cut(s) 246
MscI TGGCCA 1 cut(s) 8
MseI TTAA 2 cut(s) 209, 258
Msp20I TGGCCA 1 cut(s) 8
MspA1I CMGCKG 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 182
Mva1269I GAATGC 1 cut(s) 136
MvaI CCWGG 1 cut(s) 182
NdeII GATC 1 cut(s) 13
NlaIII CATG 2 cut(s) 40, 53
PctI GAATGC 1 cut(s) 136
PdmI GAANNNNTTC 1 cut(s) 246
PfeI GAWTC 1 cut(s) 91
PkrI GCNGC 1 cut(s) 162
Psp6I CCWGG 1 cut(s) 180
PspGI CCWGG 1 cut(s) 180
PsuI RGATCY 1 cut(s) 13
SaqAI TTAA 2 cut(s) 209, 258
SatI GCNGC 1 cut(s) 161
Sau3AI GATC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 182
SetI ASST 4 cut(s) 33, 149, 249, 282
Sse9I AATT 3 cut(s) 75, 205, 292
SsiI CCGC 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 171
TasI AATT 3 cut(s) 75, 205, 292
TauI GCSGC 1 cut(s) 163
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 2 cut(s) 209, 258
Tru9I TTAA 2 cut(s) 209, 258
TspDTI ATGAA 4 cut(s) 53, 104, 132, 239
TspGWI ACGGA 2 cut(s) 26, 277
XapI RAATTY 1 cut(s) 75
XmnI GAANNNNTTC 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.