Rorug05G0247200

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
27095700 .. 27097369
1670 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0247200.1

Sequence Viewer

Length: 249 bp
ATGAGGGAAACTGAGATTACTACCAAATATGCTACCTTTGATATGAATCATATCCAACTGAGAACAAAAGACAACAGAAAGAACCATGAGCAGAGAATCATCAATAATACTACTGCTTCAAGCATGTTTCAGTTGAACTTGATTTTGTACAGTTTACACTGCAGAGCAAGGTTTGGGTTTGTTTCGGAAAAGCTTGCTGCTAGAATTTTGATCGACTTCGGGAGAAACATTTCAATTGAAGCCGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.59

Weight (kDa)

9.74

Isoelectric Point (pI)

48.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 243
AcsI RAATTY 1 cut(s) 204
AfaI GTAC 1 cut(s) 149
AgsI TTSAA 4 cut(s) 120, 136, 234, 239
AluBI AGCT 1 cut(s) 193
AluI AGCT 1 cut(s) 193
ApeKI GCWGC 1 cut(s) 197
ApoI RAATTY 1 cut(s) 204
Asp700I GAANNNNTTC 1 cut(s) 229
BbvI GCAGC 1 cut(s) 184
BfaI CTAG 1 cut(s) 201
BfmI CTRYAG 1 cut(s) 160
BisI GCNGC 2 cut(s) 198, 243
BlsI GCNGC 2 cut(s) 199, 244
BsaBI GATNNNNATC 1 cut(s) 45
Bse8I GATNNNNATC 1 cut(s) 45
BseJI GATNNNNATC 1 cut(s) 45
BseMII CTCAG 1 cut(s) 50
BseXI GCAGC 1 cut(s) 184
Bsp1407I TGTACA 1 cut(s) 147
Bsp143I GATC 1 cut(s) 210
BspACI CCGC 1 cut(s) 243
BspCNI CTCAG 2 cut(s) 4, 51
BspMAI CTGCAG 1 cut(s) 164
BsrGI TGTACA 1 cut(s) 147
BssMI GATC 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 152
BstAUI TGTACA 1 cut(s) 147
BstC8I GCNNGC 1 cut(s) 195
BstDEI CTNAG 2 cut(s) 12, 59
BstKTI GATC 1 cut(s) 213
BstMBI GATC 1 cut(s) 210
BstNSI RCATGY 1 cut(s) 127
BstSFI CTRYAG 1 cut(s) 160
BstV1I GCAGC 1 cut(s) 184
BtsI GCAGTG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 157
Cac8I GCNNGC 1 cut(s) 195
Csp6I GTAC 1 cut(s) 148
CviAII CATG 2 cut(s) 86, 124
CviJI RGCY 2 cut(s) 193, 242
CviKI_1 RGCY 2 cut(s) 193, 242
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 2 cut(s) 12, 59
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
FaeI CATG 2 cut(s) 89, 127
FaiI YATR 5 cut(s) 30, 44, 51, 87, 125
FatI CATG 2 cut(s) 85, 123
Fnu4HI GCNGC 2 cut(s) 198, 243
Fsp4HI GCNGC 2 cut(s) 198, 243
FspBI CTAG 1 cut(s) 201
GluI GCNGC 2 cut(s) 198, 243
Hin1II CATG 2 cut(s) 89, 127
HindIII AAGCTT 1 cut(s) 191
HinfI GANTC 2 cut(s) 46, 96
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 1 cut(s) 220
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 162
HpyF3I CTNAG 2 cut(s) 12, 59
Hsp92II CATG 2 cut(s) 89, 127
Kzo9I GATC 1 cut(s) 210
Lsp1109I GCAGC 1 cut(s) 184
MaeI CTAG 1 cut(s) 201
MalI GATC 1 cut(s) 212
MboI GATC 1 cut(s) 210
MfeI CAATTG 1 cut(s) 234
MluCI AATT 2 cut(s) 204, 234
MmeI TCCRAC 1 cut(s) 79
MroXI GAANNNNTTC 1 cut(s) 229
MseI TTAA 1 cut(s) 247
MunI CAATTG 1 cut(s) 234
NdeII GATC 1 cut(s) 210
NlaIII CATG 2 cut(s) 89, 127
NspI RCATGY 1 cut(s) 127
PdmI GAANNNNTTC 1 cut(s) 229
PfeI GAWTC 2 cut(s) 46, 96
PkrI GCNGC 2 cut(s) 199, 244
PstI CTGCAG 1 cut(s) 164
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 247
SatI GCNGC 2 cut(s) 198, 243
Sau3AI GATC 1 cut(s) 210
SetI ASST 3 cut(s) 38, 173, 195
SfcI CTRYAG 1 cut(s) 160
SgeI CNNG 8 cut(s) 98, 132, 136, 151, 180, 206, 213, 232
Sse9I AATT 2 cut(s) 204, 234
SsiI CCGC 1 cut(s) 243
SspMI CTAG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 213
TasI AATT 2 cut(s) 204, 234
TatI WGTACW 1 cut(s) 147
TauI GCSGC 1 cut(s) 245
TfiI GAWTC 2 cut(s) 46, 96
Tru1I TTAA 1 cut(s) 247
Tru9I TTAA 1 cut(s) 247
TscAI CASTG 1 cut(s) 164
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 59
TspRI CASTG 1 cut(s) 164
XapI RAATTY 1 cut(s) 204
XceI RCATGY 1 cut(s) 127
XmnI GAANNNNTTC 1 cut(s) 229
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.