Rorug05G0305000

Nodulin-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
35528207 .. 35529045
839 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0305000.1

Sequence Viewer

Length: 240 bp
ATGAAGGTTGTTGCTGCATATCTTCTGGCTGTTTTGGGAGGGAACACCAGCCCCTCAGCTGATGATGTGAAGAATATTCTTAGCTCAGTTGGAGCTGAGGCTGATGTGAAAGGCAAAGATATCACTGAGCTAATTGCATCTGGAAGGGAGAAGTTGGCTGTTCCCTCTGGGGGTGGTGCAGTTGCTGTGGCTGCACCTGCAGCTGGCGGTGGTGGTGGAGCAGCCCCTGCTGTTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

7.33

Weight (kDa)

5.04

Isoelectric Point (pI)

42.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 205
Acc36I ACCTGC 1 cut(s) 205
AciI CCGC 1 cut(s) 207
AfiI CCNNNNNNNGG 2 cut(s) 170, 203
AluBI AGCT 5 cut(s) 59, 84, 95, 130, 203
AluI AGCT 5 cut(s) 59, 84, 95, 130, 203
AlwNI CAGNNNCTG 2 cut(s) 185, 227
ApeKI GCWGC 4 cut(s) 14, 191, 200, 221
BbvCI CCTCAGC 2 cut(s) 55, 96
BbvI GCAGC 3 cut(s) 178, 212, 233
BfmI CTRYAG 1 cut(s) 198
BfuAI ACCTGC 1 cut(s) 205
BisI GCNGC 4 cut(s) 15, 192, 201, 222
BlsI GCNGC 4 cut(s) 16, 193, 202, 223
BmsI GCATC 1 cut(s) 146
Bpu10I CCTNAGC 2 cut(s) 55, 96
Bsc4I CCNNNNNNNGG 2 cut(s) 170, 203
BseLI CCNNNNNNNGG 2 cut(s) 170, 203
BseMII CTCAG 4 cut(s) 69, 87, 99, 117
BseXI GCAGC 3 cut(s) 178, 212, 233
BsgI GTGCAG 2 cut(s) 177, 198
BslI CCNNNNNNNGG 2 cut(s) 170, 203
BspACI CCGC 1 cut(s) 207
BspCNI CTCAG 4 cut(s) 68, 88, 98, 118
BspMAI CTGCAG 1 cut(s) 202
BspMI ACCTGC 1 cut(s) 205
BstAPI GCANNNNNTGC 1 cut(s) 227
BstC8I GCNNGC 1 cut(s) 205
BstDEI CTNAG 6 cut(s) 55, 80, 85, 96, 126, 237
BstMWI GCNNNNNNNGC 4 cut(s) 191, 197, 200, 227
BstSFI CTRYAG 1 cut(s) 198
BstV1I GCAGC 3 cut(s) 178, 212, 233
BtsIMutI CAGTG 1 cut(s) 123
BveI ACCTGC 1 cut(s) 205
Cac8I GCNNGC 1 cut(s) 205
CaiI CAGNNNCTG 2 cut(s) 185, 227
DdeI CTNAG 6 cut(s) 55, 80, 85, 96, 126, 237
Eco32I GATATC 1 cut(s) 121
EcoRV GATATC 1 cut(s) 121
FaiI YATR 1 cut(s) 19
Fnu4HI GCNGC 4 cut(s) 15, 192, 201, 222
Fsp4HI GCNGC 4 cut(s) 15, 192, 201, 222
GluI GCNGC 4 cut(s) 15, 192, 201, 222
Hpy188III TCNNGA 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 138
HpyCH4V TGCA 5 cut(s) 17, 137, 179, 194, 200
HpyF10VI GCNNNNNNNGC 4 cut(s) 191, 197, 200, 227
HpyF3I CTNAG 6 cut(s) 55, 80, 85, 96, 126, 237
LmnI GCTCC 2 cut(s) 92, 218
LpnPI CCDG 6 cut(s) 11, 61, 126, 153, 189, 210
Lsp1109I GCAGC 3 cut(s) 178, 212, 233
LweI GCATC 1 cut(s) 146
MboII GAAGA 2 cut(s) 14, 82
MluCI AATT 1 cut(s) 132
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 4 cut(s) 32, 64, 91, 175
MspA1I CMGCKG 2 cut(s) 59, 203
MwoI GCNNNNNNNGC 4 cut(s) 191, 197, 200, 227
PaqCI CACCTGC 1 cut(s) 205
PkrI GCNGC 4 cut(s) 16, 193, 202, 223
PstI CTGCAG 1 cut(s) 202
PstNI CAGNNNCTG 2 cut(s) 185, 227
PvuII CAGCTG 2 cut(s) 59, 203
SatI GCNGC 4 cut(s) 15, 192, 201, 222
SetI ASST 7 cut(s) 9, 61, 86, 97, 132, 199, 205
SfaNI GCATC 1 cut(s) 146
SfcI CTRYAG 1 cut(s) 198
SgeI CNNG 6 cut(s) 38, 60, 153, 180, 209, 216
Sse9I AATT 1 cut(s) 132
SsiI CCGC 1 cut(s) 207
SspI AATATT 1 cut(s) 76
TasI AATT 1 cut(s) 132
TscAI CASTG 1 cut(s) 130
TseI GCWGC 4 cut(s) 14, 191, 200, 221
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.