Rorug05G0319600

Senescence regulator

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
37911748 .. 37912092
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0319600.1

Sequence Viewer

Length: 345 bp
ATGACGTCGTTTCCGCTCTTGTCTCGGGCATCGCGTAAGCTTTTAAAGCCTCCTTCACTCTCTCGCTCCCATCTCTCTGCTACAGTCTCTACCTATCACCCAACCACCAAATCCAACCCTAAAGAAATGCCCTTCATCCCATTTAATCTCAGGCACCGTTGGATTCCCAATTATCTTGATTATGATCTCAGGCTCGTAGCACATATATCCACTTCATCGAACAAGGACGACAATCAGGTCAGCGATGACCCGAAGGCCCAAGCTTTTTGGATCTACGCTTATTTGCCCAGGCAGGCCCACCCTTATGCTAAGCTGGCTCGCCTCGACAAGCCGATTGGCACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

13.11

Weight (kDa)

9.99

Isoelectric Point (pI)

49.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013237)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 236
AatII GACGTC 1 cut(s) 8
AccB1I GGYRCC 2 cut(s) 153, 338
AccBSI CCGCTC 1 cut(s) 16
AccII CGCG 1 cut(s) 34
AciI CCGC 1 cut(s) 14
AclWI GGATC 1 cut(s) 278
AcyI GRCGYC 1 cut(s) 5
AjnI CCWGG 1 cut(s) 287
AluBI AGCT 3 cut(s) 40, 263, 313
AluI AGCT 3 cut(s) 40, 263, 313
Alw26I GTCTC 2 cut(s) 27, 91
AlwI GGATC 1 cut(s) 278
Ama87I CYCGRG 1 cut(s) 24
AoxI GGCC 2 cut(s) 255, 294
AspS9I GGNCC 2 cut(s) 256, 295
AsuHPI GGTGA 1 cut(s) 89
AvaI CYCGRG 1 cut(s) 24
BanI GGYRCC 2 cut(s) 153, 338
BccI CCATC 1 cut(s) 78
BciT130I CCWGG 1 cut(s) 289
BcoDI GTCTC 2 cut(s) 27, 91
BfaI CTAG 1 cut(s) 343
BfmI CTRYAG 1 cut(s) 81
BlpI GCTNAGC 1 cut(s) 309
Bme1390I CCNGG 1 cut(s) 289
BmeT110I CYCGRG 1 cut(s) 24
BmgT120I GGNCC 2 cut(s) 256, 295
BmiI GGNNCC 2 cut(s) 155, 340
BmrFI CCNGG 1 cut(s) 289
BmsI GCATC 1 cut(s) 38
Bpu1102I GCTNAGC 1 cut(s) 309
BsaBI GATNNNNATC 1 cut(s) 183
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 287
Bse8I GATNNNNATC 1 cut(s) 183
BseBI CCWGG 1 cut(s) 289
BseDI CCNNGG 1 cut(s) 287
BseGI GGATG 1 cut(s) 135
BseJI GATNNNNATC 1 cut(s) 183
BseMII CTCAG 2 cut(s) 163, 202
Bsh1236I CGCG 1 cut(s) 34
BshFI GGCC 2 cut(s) 257, 296
BshNI GGYRCC 2 cut(s) 153, 338
BsiHKCI CYCGRG 1 cut(s) 24
BsmAI GTCTC 2 cut(s) 27, 91
BsnI GGCC 2 cut(s) 257, 296
BsoBI CYCGRG 1 cut(s) 24
Bsp143I GATC 2 cut(s) 184, 270
Bsp1720I GCTNAGC 1 cut(s) 309
BspACI CCGC 1 cut(s) 14
BspANI GGCC 2 cut(s) 257, 296
BspCNI CTCAG 2 cut(s) 162, 201
BspFNI CGCG 1 cut(s) 34
BspLI GGNNCC 2 cut(s) 155, 340
BspPI GGATC 1 cut(s) 278
BspT107I GGYRCC 2 cut(s) 153, 338
BsrBI CCGCTC 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 287
BssMI GATC 2 cut(s) 184, 270
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 289
Bst4CI ACNGT 2 cut(s) 85, 158
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 3 cut(s) 294, 315, 319
BstDEI CTNAG 3 cut(s) 149, 188, 309
BstF5I GGATG 1 cut(s) 135
BstFNI CGCG 1 cut(s) 34
BstKTI GATC 2 cut(s) 187, 273
BstMAI GTCTC 2 cut(s) 27, 91
BstMBI GATC 2 cut(s) 184, 270
BstMWI GCNNNNNNNGC 2 cut(s) 46, 314
BstNI CCWGG 1 cut(s) 289
BstSCI CCNGG 1 cut(s) 287
BstSFI CTRYAG 1 cut(s) 81
BstUI CGCG 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 270
BstYI RGATCY 1 cut(s) 270
BsuRI GGCC 2 cut(s) 257, 296
BtgZI GCGATG 2 cut(s) 15, 258
BtsCI GGATG 1 cut(s) 135
Cac8I GCNNGC 3 cut(s) 294, 315, 319
Cfr13I GGNCC 2 cut(s) 256, 295
CviJI RGCY 9 cut(s) 40, 49, 193, 257, 263, 296, 313, 317, 331
CviKI_1 RGCY 9 cut(s) 40, 49, 193, 257, 263, 296, 313, 317, 331
DdeI CTNAG 3 cut(s) 149, 188, 309
DpnI GATC 2 cut(s) 186, 272
DpnII GATC 2 cut(s) 184, 270
DraI TTTAAA 1 cut(s) 45
DrdI GACNNNNNNGTC 1 cut(s) 236
DseDI GACNNNNNNGTC 1 cut(s) 236
Eco88I CYCGRG 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 287
FaiI YATR 4 cut(s) 183, 204, 206, 306
FokI GGATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 343
HaeIII GGCC 2 cut(s) 257, 296
Hin1I GRCGYC 1 cut(s) 5
HindIII AAGCTT 2 cut(s) 38, 261
HinfI GANTC 1 cut(s) 163
HphI GGTGA 1 cut(s) 89
Hpy188III TCNNGA 1 cut(s) 176
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 3 cut(s) 63, 142, 247
HpyCH4III ACNGT 2 cut(s) 85, 158
HpyCH4IV ACGT 1 cut(s) 5
HpyF10VI GCNNNNNNNGC 2 cut(s) 46, 314
HpyF3I CTNAG 3 cut(s) 149, 188, 309
HpySE526I ACGT 1 cut(s) 5
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 2 cut(s) 184, 270
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 7 cut(s) 136, 175, 221, 274, 278, 299, 301
LweI GCATC 1 cut(s) 38
MaeI CTAG 1 cut(s) 343
MaeII ACGT 1 cut(s) 5
MalI GATC 2 cut(s) 186, 272
MbiI CCGCTC 1 cut(s) 16
MboI GATC 2 cut(s) 184, 270
MflI RGATCY 1 cut(s) 270
MluCI AATT 1 cut(s) 169
MmeI TCCRAC 2 cut(s) 138, 140
MnlI CCTC 2 cut(s) 60, 332
MseI TTAA 2 cut(s) 44, 144
MslI CAYNNNNRTG 1 cut(s) 303
MspR9I CCNGG 1 cut(s) 289
MvaI CCWGG 1 cut(s) 289
MvnI CGCG 1 cut(s) 34
MwoI GCNNNNNNNGC 2 cut(s) 46, 314
NdeII GATC 2 cut(s) 184, 270
NlaIV GGNNCC 2 cut(s) 155, 340
PcsI WCGNNNNNNNCGW 1 cut(s) 31
PfeI GAWTC 1 cut(s) 163
Psp6I CCWGG 1 cut(s) 287
PspGI CCWGG 1 cut(s) 287
PspN4I GGNNCC 2 cut(s) 155, 340
PspPI GGNCC 2 cut(s) 256, 295
PsuI RGATCY 1 cut(s) 270
RseI CAYNNNNRTG 1 cut(s) 303
SaqAI TTAA 2 cut(s) 44, 144
Sau3AI GATC 2 cut(s) 184, 270
Sau96I GGNCC 2 cut(s) 256, 295
ScrFI CCNGG 1 cut(s) 289
SetI ASST 7 cut(s) 8, 42, 95, 240, 265, 315, 344
SfaNI GCATC 1 cut(s) 38
SfcI CTRYAG 1 cut(s) 81
SmiMI CAYNNNNRTG 1 cut(s) 303
Sse9I AATT 1 cut(s) 169
SsiI CCGC 1 cut(s) 14
SspMI CTAG 1 cut(s) 343
StyD4I CCNGG 1 cut(s) 287
TaaI ACNGT 2 cut(s) 85, 158
TaiI ACGT 1 cut(s) 8
TaqI TCGA 2 cut(s) 218, 324
TasI AATT 1 cut(s) 169
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 2 cut(s) 44, 144
Tru9I TTAA 2 cut(s) 44, 144
TspDTI ATGAA 2 cut(s) 124, 204
XspI CTAG 1 cut(s) 343
ZraI GACGTC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.