Rorug05G0323400
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. RNA M5U methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
38805200 .. 38805394
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0323400.1

Sequence Viewer

Length: 195 bp
ATGCACTCGATGTTGAGAGTGATCGTACCATTATTGTTACTGCCTTTGCATAGCAATGTGGAGGATCGATCTGAAATAGGGCGCATTATCGAAGACTGTAAGTCATATTTGACATCATTACACTCTATTCAGGTTAAGCATATCTTCCGTGAAGCAAATGGTGTGGATAACTGTCACGCCCCAGATTTTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.34

Weight (kDa)

5.89

Isoelectric Point (pI)

56.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 72
AfaI GTAC 1 cut(s) 27
AgsI TTSAA 1 cut(s) 191
AhdI GACNNNNNGTC 1 cut(s) 100
AlwI GGATC 1 cut(s) 72
AspLEI GCGC 1 cut(s) 84
BbsI GAAGAC 1 cut(s) 99
BmeRI GACNNNNNGTC 1 cut(s) 100
BpiI GAAGAC 1 cut(s) 99
Bsa29I ATCGAT 1 cut(s) 67
Bse3DI GCAATG 1 cut(s) 61
BseCI ATCGAT 1 cut(s) 67
BseMI GCAATG 1 cut(s) 61
BshVI ATCGAT 1 cut(s) 67
Bsp143I GATC 3 cut(s) 21, 64, 68
BspDI ATCGAT 1 cut(s) 67
BspPI GGATC 1 cut(s) 72
BsrDI GCAATG 1 cut(s) 61
BssMI GATC 3 cut(s) 21, 64, 68
Bst4CI ACNGT 2 cut(s) 98, 173
BstHHI GCGC 1 cut(s) 84
BstKTI GATC 3 cut(s) 24, 67, 71
BstMBI GATC 3 cut(s) 21, 64, 68
BstV2I GAAGAC 1 cut(s) 99
Bsu15I ATCGAT 1 cut(s) 67
BsuTUI ATCGAT 1 cut(s) 67
CfoI GCGC 1 cut(s) 84
ClaI ATCGAT 1 cut(s) 67
Csp6I GTAC 1 cut(s) 26
CspCI CAANNNNNGTGG 2 cut(s) 144, 179
CviQI GTAC 1 cut(s) 26
DpnI GATC 3 cut(s) 23, 66, 70
DpnII GATC 3 cut(s) 21, 64, 68
DriI GACNNNNNGTC 1 cut(s) 100
Eam1105I GACNNNNNGTC 1 cut(s) 100
FaiI YATR 3 cut(s) 51, 106, 141
FalI AAGNNNNNCTT 2 cut(s) 128, 160
GlaI GCGC 1 cut(s) 83
HhaI GCGC 1 cut(s) 84
Hin6I GCGC 1 cut(s) 82
HinP1I GCGC 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 73
HpyCH4III ACNGT 2 cut(s) 98, 173
HpyCH4V TGCA 2 cut(s) 4, 49
HspAI GCGC 1 cut(s) 82
Kzo9I GATC 3 cut(s) 21, 64, 68
LpnPI CCDG 1 cut(s) 116
MaeIII GTNAC 2 cut(s) 36, 173
MalI GATC 3 cut(s) 23, 66, 70
MboI GATC 3 cut(s) 21, 64, 68
MboII GAAGA 2 cut(s) 104, 136
MnlI CCTC 1 cut(s) 55
MseI TTAA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 54
NdeII GATC 3 cut(s) 21, 64, 68
NmuCI GTSAC 1 cut(s) 173
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
RseI CAYNNNNRTG 1 cut(s) 54
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 3 cut(s) 21, 64, 68
SetI ASST 1 cut(s) 135
SgeI CNNG 4 cut(s) 19, 143, 161, 188
SmiMI CAYNNNNRTG 1 cut(s) 54
TaaI ACNGT 2 cut(s) 98, 173
TaqI TCGA 3 cut(s) 8, 67, 90
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseFI GTSAC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 173
TspGWI ACGGA 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.