Rorug05G0345500

respiratory burst oxidase homolog protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0010309
Physical Location & Seq
Reverse (-)
42565925 .. 42566113
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0345500.1

Sequence Viewer

Length: 189 bp
ATGATTAAAACAAGAAGGCATGGGTCATACGGGTTGGAGATTAAAATGGATCCGACCCTGCAAAGGTTTGAGTTGAATCTCGATTCTTCTCAAGTTGTCTTCTTTAGCACAACTTCGTCCGTTTCTTCAGTCCTTCAAGCCCACCCCAACTCCCAGTTCTTCAGTTACTTCAAGGTTGCTGCGTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04624 map04013 map04624
Pfam Domains
Protein Families
EF-hand_6 FAD_binding_8 Ferric_reduct NADPH_Ox NAD_binding_6

Protein Analysis

62

Amino Acids

7.09

Weight (kDa)

9.3

Isoelectric Point (pI)

45.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 44, 57
AcuI CTGAAG 2 cut(s) 111, 145
AfaI GTAC 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 63
AgsI TTSAA 3 cut(s) 76, 137, 172
AjuI GAANNNNNNNTTGG 2 cut(s) 140, 172
AlwI GGATC 2 cut(s) 44, 57
ApeKI GCWGC 1 cut(s) 179
BamHI GGATCC 1 cut(s) 49
BbsI GAAGAC 1 cut(s) 91
BbvI GCAGC 1 cut(s) 166
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
BmiI GGNNCC 1 cut(s) 51
BmrI ACTGGG 1 cut(s) 148
BmuI ACTGGG 1 cut(s) 148
BpiI GAAGAC 1 cut(s) 91
BpuEI CTTGAG 1 cut(s) 75
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
Bsc4I CCNNNNNNNGG 1 cut(s) 63
Bse1I ACTGG 1 cut(s) 154
BseLI CCNNNNNNNGG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 154
BseXI GCAGC 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 63
Bsp143I GATC 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 51
BspPI GGATC 2 cut(s) 44, 57
BsrI ACTGG 1 cut(s) 154
BssMI GATC 1 cut(s) 49
BstKTI GATC 1 cut(s) 52
BstMBI GATC 1 cut(s) 49
BstV1I GCAGC 1 cut(s) 166
BstV2I GAAGAC 1 cut(s) 91
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
Csp6I GTAC 1 cut(s) 184
CviAII CATG 1 cut(s) 20
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
CviQI GTAC 1 cut(s) 184
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
Eco57I CTGAAG 2 cut(s) 111, 145
FaeI CATG 1 cut(s) 23
FaiI YATR 2 cut(s) 21, 28
FatI CATG 1 cut(s) 19
Fnu4HI GCNGC 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 180
GluI GCNGC 1 cut(s) 180
Hin1II CATG 1 cut(s) 23
HinfI GANTC 2 cut(s) 76, 83
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 80
HpyAV CCTTC 2 cut(s) 9, 143
HpyCH4V TGCA 1 cut(s) 61
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 71, 167
Lsp1109I GCAGC 1 cut(s) 166
MaeIII GTNAC 1 cut(s) 164
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MboII GAAGA 4 cut(s) 78, 91, 117, 151
MflI RGATCY 1 cut(s) 49
MmeI TCCRAC 2 cut(s) 15, 77
MseI TTAA 2 cut(s) 6, 42
NdeII GATC 1 cut(s) 49
NlaIII CATG 1 cut(s) 23
NlaIV GGNNCC 1 cut(s) 51
PfeI GAWTC 2 cut(s) 76, 83
PkrI GCNGC 1 cut(s) 181
PspN4I GGNNCC 1 cut(s) 51
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 1 cut(s) 185
RsaNI GTAC 1 cut(s) 184
SaqAI TTAA 2 cut(s) 6, 42
SatI GCNGC 1 cut(s) 180
Sau3AI GATC 1 cut(s) 49
SetI ASST 2 cut(s) 68, 177
SgeI CNNG 9 cut(s) 24, 32, 43, 70, 92, 104, 149, 166, 184
SmlI CTYRAG 1 cut(s) 90
SmoI CTYRAG 1 cut(s) 90
TaqI TCGA 1 cut(s) 81
TfiI GAWTC 2 cut(s) 76, 83
Tru1I TTAA 2 cut(s) 6, 42
Tru9I TTAA 2 cut(s) 6, 42
TseI GCWGC 1 cut(s) 179
TspGWI ACGGA 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.