Rorug05G0434600

KH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0007994
Physical Location & Seq
Forward (+)
60338558 .. 60338978
421 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0434600.1

Sequence Viewer

Length: 333 bp
ATGGGGTTCAGTTTATCTGTCTTGGCTCAATTCTTCAAATCTGGTCTTGAACCAAATGTCACCACCTTCACCACTCTAATCAACGGCTTTCTTCTTCAGAATAAAGTGGCTGAAGCAGCAGCAATTTTCAGCAAAAATGGTGGAGGCAGGAAGATGGAAGAAGGACCTTGCAAGCCTGATGTAGTTGTCTATAGCACCATCATTGACACTCTTTGTAAGGATGCACTAATTATGGAAGCATTGAACCTCTTCTCAGAAATGATTAGCAGAGGCATAGACCCAGATGTCATTACCTATAACTCTTTGATTGATGGAGCTTGCAAAAGTAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KH_1 STAR_dimer

Protein Analysis

110

Amino Acids

11.9

Weight (kDa)

4.99

Isoelectric Point (pI)

21.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_3 PF13812 10 - 71 3.2e-07 Pentatricopeptide repeat domain
PPR_1 PF12854 15 - 44 9.7e-07 PPR repeat
PPR_1 PF12854 57 - 87 5.1e-11 PPR repeat
PPR_2 PF13041 59 - 108 4.7e-18 PPR repeat family
PPR PF01535 62 - 92 7e-06 PPR repeat
PPR_1 PF12854 90 - 108 2.1e-07 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 284
AcuI CTGAAG 2 cut(s) 80, 132
AgsI TTSAA 3 cut(s) 37, 50, 244
AluBI AGCT 1 cut(s) 317
AluI AGCT 1 cut(s) 317
ApeKI GCWGC 2 cut(s) 116, 119
Asp700I GAANNNNTTC 1 cut(s) 248
AspS9I GGNCC 1 cut(s) 164
AsuHPI GGTGA 2 cut(s) 52, 61
AvaII GGWCC 1 cut(s) 164
BbvI GCAGC 2 cut(s) 128, 131
BccI CCATC 3 cut(s) 148, 206, 305
BceAI ACGGC 1 cut(s) 100
BfmI CTRYAG 1 cut(s) 190
BisI GCNGC 2 cut(s) 117, 120
BlsI GCNGC 2 cut(s) 118, 121
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 164
BmsI GCATC 1 cut(s) 211
BseGI GGATG 1 cut(s) 226
BseMII CTCAG 1 cut(s) 267
BseXI GCAGC 2 cut(s) 128, 131
BspCNI CTCAG 1 cut(s) 266
Bst6I CTCTTC 1 cut(s) 254
BstC8I GCNNGC 2 cut(s) 173, 319
BstDEI CTNAG 1 cut(s) 253
BstF5I GGATG 1 cut(s) 226
BstMWI GCNNNNNNNGC 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 190
BstV1I GCAGC 2 cut(s) 128, 131
BtsCI GGATG 1 cut(s) 226
Cac8I GCNNGC 2 cut(s) 173, 319
Cfr13I GGNCC 1 cut(s) 164
CspCI CAANNNNNGTGG 2 cut(s) 121, 156
CviJI RGCY 5 cut(s) 26, 87, 110, 175, 317
CviKI_1 RGCY 5 cut(s) 26, 87, 110, 175, 317
DdeI CTNAG 1 cut(s) 253
DrdI GACNNNNNNGTC 1 cut(s) 284
DseDI GACNNNNNNGTC 1 cut(s) 284
Eam1104I CTCTTC 1 cut(s) 254
EarI CTCTTC 1 cut(s) 254
Eco47I GGWCC 1 cut(s) 164
Eco57I CTGAAG 2 cut(s) 80, 132
EcoO109I RGGNCCY 1 cut(s) 164
FaiI YATR 4 cut(s) 192, 233, 275, 297
Fnu4HI GCNGC 2 cut(s) 117, 120
FokI GGATG 1 cut(s) 233
Fsp4HI GCNGC 2 cut(s) 117, 120
GluI GCNGC 2 cut(s) 117, 120
HphI GGTGA 2 cut(s) 52, 61
Hpy188I TCNGA 2 cut(s) 99, 256
Hpy188III TCNNGA 1 cut(s) 47
HpyAV CCTTC 2 cut(s) 76, 155
HpyCH4V TGCA 3 cut(s) 171, 224, 321
HpyF10VI GCNNNNNNNGC 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 253
LmnI GCTCC 1 cut(s) 314
LpnPI CCDG 4 cut(s) 27, 133, 189, 294
Lsp1109I GCAGC 2 cut(s) 128, 131
LweI GCATC 1 cut(s) 211
MaeIII GTNAC 1 cut(s) 58
MboII GAAGA 6 cut(s) 25, 83, 86, 163, 170, 241
MluCI AATT 3 cut(s) 29, 123, 228
MnlI CCTC 3 cut(s) 137, 257, 263
MroXI GAANNNNTTC 1 cut(s) 248
MwoI GCNNNNNNNGC 1 cut(s) 116
NmuCI GTSAC 1 cut(s) 58
PdmI GAANNNNTTC 1 cut(s) 248
PkrI GCNGC 2 cut(s) 118, 121
PpuMI RGGWCCY 1 cut(s) 164
Psp5II RGGWCCY 1 cut(s) 164
PspPI GGNCC 1 cut(s) 164
PspPPI RGGWCCY 1 cut(s) 164
SatI GCNGC 2 cut(s) 117, 120
Sau96I GGNCC 1 cut(s) 164
SetI ASST 6 cut(s) 68, 169, 249, 296, 319, 332
SfaNI GCATC 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 190
SgeI CNNG 8 cut(s) 34, 54, 59, 160, 180, 184, 188, 293
SinI GGWCC 1 cut(s) 164
Sse9I AATT 3 cut(s) 29, 123, 228
TasI AATT 3 cut(s) 29, 123, 228
TseFI GTSAC 1 cut(s) 58
TseI GCWGC 2 cut(s) 116, 119
Tsp45I GTSAC 1 cut(s) 58
VpaK11BI GGWCC 1 cut(s) 164
XmnI GAANNNNTTC 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.