Rh5DG525500

KH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0007994
Physical Location & Seq
Reverse (-)
81328386 .. 81333527
5142 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG525500.1

Sequence Viewer

Length: 429 bp
ATGTCAAGTTTATTACAGCCCTCATCAACACAAAATTGGCTTAGTCCTCAAAGTAGCTCATCTGGTCTAATTGTTAAGCGGACAATCAGAGTGGATATTCCCGTTGACAAATATCCTAATTATAACTTTGTTGGGCGGTTGCTAGGTCCTAGGGGAAACTCTCTTAAGCGAGTGGAAGCAACTACTGAGTGCCGTGTTCTGATCAGGGGCCGTGGTAGCATAAAGGATCCAGCCAGGGAAGATATGATGAGAGGTAAACCGGGGTATGAACATTTGAATGAACCTCTTCATATACTAGTGGAGGCAGAACTACCAGTTGAAATTGTTGATGCTCGTTTATTACAAGCACGTGAAGTACTTGAAGATCTGCTCAGGCCTGTGGTATGTTTTTTCTTTCCTTGTGAAGAGCAAATTTTTCTTTTCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KH_1 STAR_dimer

Protein Analysis

142

Amino Acids

16.16

Weight (kDa)

6.74

Isoelectric Point (pI)

52.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KH-I_KHDC4-BBP PF22675 37 - 124 5.7e-20 KHDC4/BBP-like, KH-domain type I
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 123
AciI CCGC 2 cut(s) 79, 136
AclWI GGATC 2 cut(s) 221, 234
AcsI RAATTY 1 cut(s) 411
AcvI CACGTG 1 cut(s) 350
AfaI GTAC 1 cut(s) 357
AflII CTTAAG 1 cut(s) 164
AgsI TTSAA 3 cut(s) 277, 320, 362
AhlI ACTAGT 1 cut(s) 295
AjnI CCWGG 1 cut(s) 233
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AlwI GGATC 2 cut(s) 221, 234
AoxI GGCC 2 cut(s) 208, 374
ApoI RAATTY 1 cut(s) 411
Asp700I GAANNNNTTC 1 cut(s) 285
AspA2I CCTAGG 1 cut(s) 149
AspS9I GGNCC 2 cut(s) 146, 208
AsuC2I CCSGG 1 cut(s) 261
AvaII GGWCC 1 cut(s) 146
AvrII CCTAGG 1 cut(s) 149
BamHI GGATCC 1 cut(s) 226
BbrPI CACGTG 1 cut(s) 350
BceAI ACGGC 2 cut(s) 177, 195
BciT130I CCWGG 1 cut(s) 235
BclI TGATCA 1 cut(s) 201
BcnI CCSGG 1 cut(s) 261
BcuI ACTAGT 1 cut(s) 295
BfaI CTAG 4 cut(s) 143, 150, 296, 427
BfrI CTTAAG 1 cut(s) 164
BglII AGATCT 1 cut(s) 364
BlnI CCTAGG 1 cut(s) 149
BmcAI AGTACT 1 cut(s) 357
Bme1390I CCNGG 2 cut(s) 235, 261
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 2 cut(s) 146, 208
BmiI GGNNCC 2 cut(s) 209, 228
BmrFI CCNGG 2 cut(s) 235, 261
BmsI GCATC 1 cut(s) 319
Bpu10I CCTNAGC 1 cut(s) 371
BpuMI CCSGG 1 cut(s) 261
BsaAI YACGTR 1 cut(s) 350
BsaJI CCNNGG 4 cut(s) 149, 211, 234, 260
Bse1I ACTGG 1 cut(s) 314
BseBI CCWGG 1 cut(s) 235
BseDI CCNNGG 4 cut(s) 149, 211, 234, 260
BseMII CTCAG 2 cut(s) 177, 385
BseNI ACTGG 1 cut(s) 314
BshFI GGCC 2 cut(s) 210, 376
BsiSI CCGG 1 cut(s) 260
BsnI GGCC 2 cut(s) 210, 376
Bsp143I GATC 3 cut(s) 201, 226, 364
BspACI CCGC 2 cut(s) 79, 136
BspANI GGCC 2 cut(s) 210, 376
BspCNI CTCAG 2 cut(s) 178, 384
BspLI GGNNCC 2 cut(s) 209, 228
BspPI GGATC 2 cut(s) 221, 234
BspQI GCTCTTC 1 cut(s) 399
BspTI CTTAAG 1 cut(s) 164
BsrI ACTGG 1 cut(s) 314
BssECI CCNNGG 4 cut(s) 149, 211, 234, 260
BssMI GATC 3 cut(s) 201, 226, 364
BssT1I CCWWGG 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 235
Bst6I CTCTTC 2 cut(s) 291, 399
BstAFI CTTAAG 1 cut(s) 164
BstBAI YACGTR 1 cut(s) 350
BstDEI CTNAG 3 cut(s) 41, 186, 371
BstDSI CCRYGG 1 cut(s) 211
BstKTI GATC 3 cut(s) 204, 229, 367
BstMBI GATC 3 cut(s) 201, 226, 364
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstNI CCWGG 1 cut(s) 235
BstSCI CCNGG 2 cut(s) 233, 259
BstX2I RGATCY 2 cut(s) 226, 364
BstYI RGATCY 2 cut(s) 226, 364
BsuRI GGCC 2 cut(s) 210, 376
BtgI CCRYGG 1 cut(s) 211
Cfr13I GGNCC 2 cut(s) 146, 208
Csp6I GTAC 1 cut(s) 356
CspCI CAANNNNNGTGG 2 cut(s) 72, 107
CviJI RGCY 6 cut(s) 19, 40, 57, 210, 233, 376
CviKI_1 RGCY 6 cut(s) 19, 40, 57, 210, 233, 376
CviQI GTAC 1 cut(s) 356
DdeI CTNAG 3 cut(s) 41, 186, 371
DpnI GATC 3 cut(s) 203, 228, 366
DpnII GATC 3 cut(s) 201, 226, 364
Eam1104I CTCTTC 2 cut(s) 291, 399
EarI CTCTTC 2 cut(s) 291, 399
Eco130I CCWWGG 1 cut(s) 149
Eco147I AGGCCT 1 cut(s) 376
Eco47I GGWCC 1 cut(s) 146
Eco72I CACGTG 1 cut(s) 350
EcoO109I RGGNCCY 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 233
EcoT14I CCWWGG 1 cut(s) 149
ErhI CCWWGG 1 cut(s) 149
FaiI YATR 7 cut(s) 123, 221, 245, 267, 291, 293, 385
FbaI TGATCA 1 cut(s) 201
FspBI CTAG 4 cut(s) 143, 150, 296, 427
HaeIII GGCC 2 cut(s) 210, 376
HapII CCGG 1 cut(s) 260
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HpaII CCGG 1 cut(s) 260
Hpy166II GTNNAC 2 cut(s) 106, 257
Hpy188I TCNGA 2 cut(s) 89, 201
Hpy8I GTNNAC 2 cut(s) 106, 257
HpyCH4IV ACGT 1 cut(s) 349
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
HpyF3I CTNAG 3 cut(s) 41, 186, 371
HpySE526I ACGT 1 cut(s) 349
Ksp22I TGATCA 1 cut(s) 201
Kzo9I GATC 3 cut(s) 201, 226, 364
LguI GCTCTTC 1 cut(s) 399
LpnPI CCDG 9 cut(s) 48, 190, 220, 243, 247, 273, 327, 358, 390
LweI GCATC 1 cut(s) 319
MaeI CTAG 4 cut(s) 143, 150, 296, 427
MaeII ACGT 1 cut(s) 349
MalI GATC 3 cut(s) 203, 228, 366
MboI GATC 3 cut(s) 201, 226, 364
MboII GAAGA 4 cut(s) 251, 278, 374, 416
MflI RGATCY 2 cut(s) 226, 364
MluCI AATT 5 cut(s) 34, 69, 118, 321, 411
MnlI CCTC 5 cut(s) 31, 57, 245, 294, 295
MroXI GAANNNNTTC 1 cut(s) 285
MseI TTAA 2 cut(s) 75, 165
MslI CAYNNNNRTG 1 cut(s) 276
MspCI CTTAAG 1 cut(s) 164
MspI CCGG 1 cut(s) 260
MspR9I CCNGG 2 cut(s) 235, 261
MvaI CCWGG 1 cut(s) 235
MwoI GCNNNNNNNGC 1 cut(s) 216
NciI CCSGG 1 cut(s) 261
NdeII GATC 3 cut(s) 201, 226, 364
NlaIV GGNNCC 2 cut(s) 209, 228
PceI AGGCCT 1 cut(s) 376
PciSI GCTCTTC 1 cut(s) 399
PdmI GAANNNNTTC 1 cut(s) 285
PmaCI CACGTG 1 cut(s) 350
PmlI CACGTG 1 cut(s) 350
Ppu21I YACGTR 1 cut(s) 350
PpuMI RGGWCCY 1 cut(s) 146
PsiI TTATAA 1 cut(s) 123
Psp5II RGGWCCY 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 233
PspCI CACGTG 1 cut(s) 350
PspGI CCWGG 1 cut(s) 233
PspN4I GGNNCC 2 cut(s) 209, 228
PspPI GGNCC 2 cut(s) 146, 208
PspPPI RGGWCCY 1 cut(s) 146
PsuI RGATCY 2 cut(s) 226, 364
RsaI GTAC 1 cut(s) 357
RsaNI GTAC 1 cut(s) 356
RseI CAYNNNNRTG 1 cut(s) 276
SapI GCTCTTC 1 cut(s) 399
SaqAI TTAA 2 cut(s) 75, 165
Sau3AI GATC 3 cut(s) 201, 226, 364
Sau96I GGNCC 2 cut(s) 146, 208
ScaI AGTACT 1 cut(s) 357
ScrFI CCNGG 2 cut(s) 235, 261
SetI ASST 5 cut(s) 59, 148, 256, 286, 352
SfaNI GCATC 1 cut(s) 319
SinI GGWCC 1 cut(s) 146
SmiMI CAYNNNNRTG 1 cut(s) 276
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
SpeI ACTAGT 1 cut(s) 295
Sse9I AATT 5 cut(s) 34, 69, 118, 321, 411
SseBI AGGCCT 1 cut(s) 376
SsiI CCGC 2 cut(s) 79, 136
SspMI CTAG 4 cut(s) 143, 150, 296, 427
StuI AGGCCT 1 cut(s) 376
StyD4I CCNGG 2 cut(s) 233, 259
StyI CCWWGG 1 cut(s) 149
TaiI ACGT 1 cut(s) 352
TasI AATT 5 cut(s) 34, 69, 118, 321, 411
TatI WGTACW 1 cut(s) 355
Tru1I TTAA 2 cut(s) 75, 165
Tru9I TTAA 2 cut(s) 75, 165
TspDTI ATGAA 3 cut(s) 278, 282, 294
Vha464I CTTAAG 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 146
XapI RAATTY 1 cut(s) 411
XmaJI CCTAGG 1 cut(s) 149
XmnI GAANNNNTTC 1 cut(s) 285
XspI CTAG 4 cut(s) 143, 150, 296, 427
ZrmI AGTACT 1 cut(s) 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.