Rorug05G0588100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0010427
Physical Location & Seq
Forward (+)
78652216 .. 78652716
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0588100.1

Sequence Viewer

Length: 501 bp
ATGGCCTCATCCATCACCCAAATCTCTCTCTTCCTTCTATTCCTAACTCTCTTCTCAGAAACCCAATTATCTCAATCCCTCAGAGACCTCAAACCCAACCCCAACCGTCCATCCACCTCGCTCCAATCAATCACAGACGTCCATGACCTCCTCCCCAAGTACGGCCTCCCAAAGGGTCTGTTACCCGACAACGTAAGATCCTACACTCTCTCTGACGATGGAACCTTCTCGATCTATCTCGAAAACCCATGTTATGTTCACTTTGATCAGTTGGTGTACTACAATAAGAACATTAAAGGGAAGCTGAGTTTCGGCTCTGTTTCCGATGTGTCGGGGATTCAAGCCAAGAAGCTGTTTATTTGGGTTACCGTGACGGGGATGCATATGGAACAAGGGTCTGATTCGGGGATGCATCACCGAGAACAGCTCCAGGCTCCTTTATTCAATGGACCCTCCACAATCCCTAGACCACGAAGCATTGAAGGATTTGAAGGATCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

166

Amino Acids

18.54

Weight (kDa)

6.5

Isoelectric Point (pI)

45.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF538 PF04398 47 - 131 1.5e-25 Protein of unknown function, DUF538
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010427)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G49510 AT1G49510 AT1G49510
fragaria_vesca FvH4_2g06990 FvH4_2g07010
malus_domestica MD00G1050600.v1.1
prunus_persica Prupe.8G115700_v2.0.a1
pyrus_communis pycom05g06730
rosa_chinensis RchiOBHm_Chr6g0259351
rosa_laevigata RLG00000014537
rosa_multiflora Rmu_ssc0000050.1_g000059
rosa_roxburghii Rroxscaffold_7G00206590
rosa_rugosa Rorug05G0587800 Rorug05G0587900.1 Rorug05G0588000 Rorug05G0588100
rosa_samantha Rh6AG103800 Rh6BG097000 Rh6CG093200 Rh6DG087000
rosa_wichuraiana Rw6G008960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 141
AclWI GGATC 1 cut(s) 192
AcyI GRCGYC 1 cut(s) 138
AfaI GTAC 2 cut(s) 161, 278
AfiI CCNNNNNNNGG 3 cut(s) 161, 172, 375
AgsI TTSAA 4 cut(s) 341, 445, 482, 491
AjnI CCWGG 1 cut(s) 429
AluBI AGCT 3 cut(s) 304, 352, 427
AluI AGCT 3 cut(s) 304, 352, 427
Alw26I GTCTC 1 cut(s) 78
AlwI GGATC 1 cut(s) 192
AoxI GGCC 2 cut(s) 3, 163
AspS9I GGNCC 1 cut(s) 449
AsuHPI GGTGA 2 cut(s) 7, 407
AvaII GGWCC 1 cut(s) 449
BccI CCATC 3 cut(s) 20, 118, 212
BceAI ACGGC 1 cut(s) 178
BciT130I CCWGG 1 cut(s) 431
BclI TGATCA 1 cut(s) 265
BcoDI GTCTC 1 cut(s) 78
BfaI CTAG 1 cut(s) 465
Bme1390I CCNGG 1 cut(s) 431
Bme18I GGWCC 1 cut(s) 449
BmgT120I GGNCC 1 cut(s) 449
BmiI GGNNCC 3 cut(s) 223, 435, 451
BmrFI CCNGG 1 cut(s) 431
BmsI GCATC 3 cut(s) 369, 399, 421
BplI GAGNNNNNCTC 2 cut(s) 411, 443
BpmI CTGGAG 1 cut(s) 413
BsaHI GRCGYC 1 cut(s) 138
BsaI GGTCTC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 3 cut(s) 161, 172, 375
BseBI CCWGG 1 cut(s) 431
BseGI GGATG 4 cut(s) 8, 110, 384, 414
BseLI CCNNNNNNNGG 3 cut(s) 161, 172, 375
BseMII CTCAG 3 cut(s) 69, 94, 296
BseRI GAGGAG 1 cut(s) 140
BshFI GGCC 2 cut(s) 5, 165
BslI CCNNNNNNNGG 3 cut(s) 161, 172, 375
BsmAI GTCTC 1 cut(s) 78
BsnI GGCC 2 cut(s) 5, 165
Bso31I GGTCTC 1 cut(s) 78
Bsp143I GATC 4 cut(s) 197, 231, 265, 494
BspANI GGCC 2 cut(s) 5, 165
BspCNI CTCAG 3 cut(s) 68, 93, 297
BspLI GGNNCC 3 cut(s) 223, 435, 451
BspPI GGATC 1 cut(s) 192
BspTNI GGTCTC 1 cut(s) 78
BssMI GATC 4 cut(s) 197, 231, 265, 494
BssNI GRCGYC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 431
Bst4CI ACNGT 2 cut(s) 107, 370
Bst6I CTCTTC 2 cut(s) 35, 56
BstACI GRCGYC 1 cut(s) 138
BstDEI CTNAG 3 cut(s) 55, 80, 305
BstEII GGTNACC 1 cut(s) 364
BstENI CCTNNNNNAGG 1 cut(s) 170
BstF5I GGATG 4 cut(s) 8, 110, 384, 414
BstKTI GATC 4 cut(s) 200, 234, 268, 497
BstMAI GTCTC 1 cut(s) 78
BstMBI GATC 4 cut(s) 197, 231, 265, 494
BstNI CCWGG 1 cut(s) 431
BstPI GGTNACC 1 cut(s) 364
BstSCI CCNGG 1 cut(s) 429
BstX2I RGATCY 1 cut(s) 197
BstYI RGATCY 1 cut(s) 197
BsuRI GGCC 2 cut(s) 5, 165
BtsCI GGATG 4 cut(s) 8, 110, 384, 414
Cfr13I GGNCC 1 cut(s) 449
Csp6I GTAC 2 cut(s) 160, 277
CviAII CATG 2 cut(s) 143, 249
CviJI RGCY 8 cut(s) 5, 165, 304, 315, 344, 352, 427, 434
CviKI_1 RGCY 8 cut(s) 5, 165, 304, 315, 344, 352, 427, 434
CviQI GTAC 2 cut(s) 160, 277
DdeI CTNAG 3 cut(s) 55, 80, 305
DpnI GATC 4 cut(s) 199, 233, 267, 496
DpnII GATC 4 cut(s) 197, 231, 265, 494
Eam1104I CTCTTC 2 cut(s) 35, 56
EarI CTCTTC 2 cut(s) 35, 56
Eco31I GGTCTC 1 cut(s) 78
Eco47I GGWCC 1 cut(s) 449
Eco91I GGTNACC 1 cut(s) 364
EcoNI CCTNNNNNAGG 1 cut(s) 170
EcoO65I GGTNACC 1 cut(s) 364
EcoRII CCWGG 1 cut(s) 429
EcoT22I ATGCAT 2 cut(s) 384, 414
FaeI CATG 2 cut(s) 146, 252
FaiI YATR 6 cut(s) 144, 250, 255, 384, 386, 499
FatI CATG 2 cut(s) 142, 248
FauNDI CATATG 1 cut(s) 384
FbaI TGATCA 1 cut(s) 265
FokI GGATG 3 cut(s) 97, 391, 421
FspBI CTAG 1 cut(s) 465
GsuI CTGGAG 1 cut(s) 413
HaeIII GGCC 2 cut(s) 5, 165
Hin1I GRCGYC 1 cut(s) 138
Hin1II CATG 2 cut(s) 146, 252
HinfI GANTC 2 cut(s) 337, 401
HphI GGTGA 2 cut(s) 7, 407
Hpy166II GTNNAC 2 cut(s) 259, 277
Hpy188I TCNGA 5 cut(s) 58, 83, 214, 325, 400
Hpy188III TCNNGA 2 cut(s) 229, 239
Hpy8I GTNNAC 2 cut(s) 259, 277
HpyAV CCTTC 4 cut(s) 44, 235, 476, 485
HpyCH4III ACNGT 2 cut(s) 107, 370
HpyCH4IV ACGT 2 cut(s) 138, 192
HpyCH4V TGCA 2 cut(s) 382, 412
HpyF3I CTNAG 3 cut(s) 55, 80, 305
HpySE526I ACGT 2 cut(s) 138, 192
Hsp92I GRCGYC 1 cut(s) 138
Hsp92II CATG 2 cut(s) 146, 252
Ksp22I TGATCA 1 cut(s) 265
Kzo9I GATC 4 cut(s) 197, 231, 265, 494
LmnI GCTCC 3 cut(s) 126, 432, 439
LpnPI CCDG 2 cut(s) 416, 443
LweI GCATC 3 cut(s) 369, 399, 421
MaeI CTAG 1 cut(s) 465
MaeII ACGT 2 cut(s) 138, 192
MaeIII GTNAC 3 cut(s) 180, 364, 370
MalI GATC 4 cut(s) 199, 233, 267, 496
MboI GATC 4 cut(s) 197, 231, 265, 494
MboII GAAGA 2 cut(s) 22, 43
MflI RGATCY 1 cut(s) 197
MluCI AATT 1 cut(s) 65
MnlI CCTC 8 cut(s) 16, 89, 98, 127, 158, 161, 176, 463
Mph1103I ATGCAT 2 cut(s) 384, 414
MseI TTAA 1 cut(s) 294
MspR9I CCNGG 1 cut(s) 431
MvaI CCWGG 1 cut(s) 431
NdeI CATATG 1 cut(s) 384
NdeII GATC 4 cut(s) 197, 231, 265, 494
NlaIII CATG 2 cut(s) 146, 252
NlaIV GGNNCC 3 cut(s) 223, 435, 451
NmuCI GTSAC 1 cut(s) 370
NsiI ATGCAT 2 cut(s) 384, 414
PfeI GAWTC 2 cut(s) 337, 401
Psp6I CCWGG 1 cut(s) 429
PspEI GGTNACC 1 cut(s) 364
PspGI CCWGG 1 cut(s) 429
PspN4I GGNNCC 3 cut(s) 223, 435, 451
PspPI GGNCC 1 cut(s) 449
PsuI RGATCY 1 cut(s) 197
RsaI GTAC 2 cut(s) 161, 278
RsaNI GTAC 2 cut(s) 160, 277
SaqAI TTAA 1 cut(s) 294
Sau3AI GATC 4 cut(s) 197, 231, 265, 494
Sau96I GGNCC 1 cut(s) 449
ScrFI CCNGG 1 cut(s) 431
SetI ASST 9 cut(s) 90, 119, 141, 150, 195, 227, 306, 354, 429
SfaNI GCATC 3 cut(s) 369, 399, 421
SinI GGWCC 1 cut(s) 449
Sse9I AATT 1 cut(s) 65
SspMI CTAG 1 cut(s) 465
StyD4I CCNGG 1 cut(s) 429
TaaI ACNGT 2 cut(s) 107, 370
TaiI ACGT 2 cut(s) 141, 195
TaqI TCGA 2 cut(s) 230, 240
TasI AATT 1 cut(s) 65
TatI WGTACW 1 cut(s) 276
TfiI GAWTC 2 cut(s) 337, 401
Tru1I TTAA 1 cut(s) 294
Tru9I TTAA 1 cut(s) 294
TseFI GTSAC 1 cut(s) 370
Tsp45I GTSAC 1 cut(s) 370
VpaK11BI GGWCC 1 cut(s) 449
XagI CCTNNNNNAGG 1 cut(s) 170
XspI CTAG 1 cut(s) 465
ZraI GACGTC 1 cut(s) 139
Zsp2I ATGCAT 2 cut(s) 384, 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.