Rorug06G0356000

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0003187
Physical Location & Seq
Reverse (-)
50355634 .. 50358649
3016 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0356000.1

Sequence Viewer

Length: 489 bp
ATGGAGATGGCAGCTGAGAAAGCCAAGAGAGGGATAAAGAGGTTCTTGGAACAATCCACAGGTGACCGAGTTGAACAAGGAGAATCTAAATGTATTCGTGTCAAATCAAAGAGATTGAAAACAATGTTTCATCCAGAAATTGCTGGAGGATCTAATGAATGTCAGAATGAAATGCAATCAGGAGATGGTGATCAAAATGTCACTCAAGATTCATTTGTGGAATTAAATGAAAATAATTCTTTCCAACGCCTCCCAACTGATGTCACAAATATGGCAGCTAAGAATACCAAGAGAGGAAGAAAAAAGTTCTTAAAACAATCTACTGGTGAGAAAGTTGTATGCAGTCATGTTAGATCAAAGAGATTGAAAAGAATGTTTTGTCCAAGCATTACTGAAGGATCTAATGAATGTGAGAATGGAAGTCAACTTATAGATGGTGATAAAGACAGTGCTCCAGTGATGACAATTTACATTTGCAAGTCTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF547 Lzipper-MIP1

Protein Analysis

162

Amino Acids

18.15

Weight (kDa)

9.05

Isoelectric Point (pI)

48.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 157, 406
AcuI CTGAAG 1 cut(s) 414
AfiI CCNNNNNNNGG 1 cut(s) 30
AgsI TTSAA 3 cut(s) 74, 118, 367
AluBI AGCT 2 cut(s) 14, 278
AluI AGCT 2 cut(s) 14, 278
Alw21I GWGCWC 1 cut(s) 454
AlwI GGATC 2 cut(s) 157, 406
ApeKI GCWGC 2 cut(s) 11, 275
AsuHPI GGTGA 4 cut(s) 74, 200, 338, 449
BbsI GAAGAC 1 cut(s) 474
Bbv12I GWGCWC 1 cut(s) 454
BbvI GCAGC 2 cut(s) 23, 287
BccI CCATC 2 cut(s) 179, 428
BclI TGATCA 1 cut(s) 190
BisI GCNGC 2 cut(s) 12, 276
BlsI GCNGC 2 cut(s) 13, 277
BpiI GAAGAC 1 cut(s) 474
BpmI CTGGAG 2 cut(s) 165, 438
BpuEI CTTGAG 1 cut(s) 189
BsaBI GATNNNNATC 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 30
Bse1I ACTGG 2 cut(s) 328, 455
Bse8I GATNNNNATC 1 cut(s) 189
BseGI GGATG 1 cut(s) 130
BseJI GATNNNNATC 1 cut(s) 189
BseLI CCNNNNNNNGG 1 cut(s) 30
BseMII CTCAG 1 cut(s) 6
BseNI ACTGG 2 cut(s) 328, 455
BseXI GCAGC 2 cut(s) 23, 287
BsiHKAI GWGCWC 1 cut(s) 454
BslI CCNNNNNNNGG 1 cut(s) 30
Bsp1286I GDGCHC 1 cut(s) 454
Bsp143I GATC 4 cut(s) 149, 190, 353, 398
BspCNI CTCAG 1 cut(s) 7
BspPI GGATC 2 cut(s) 157, 406
BsrI ACTGG 2 cut(s) 328, 455
BssMI GATC 4 cut(s) 149, 190, 353, 398
Bst4CI ACNGT 1 cut(s) 449
BstDEI CTNAG 2 cut(s) 15, 279
BstEII GGTNACC 1 cut(s) 62
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 4 cut(s) 152, 193, 356, 401
BstMBI GATC 4 cut(s) 149, 190, 353, 398
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstPI GGTNACC 1 cut(s) 62
BstV1I GCAGC 2 cut(s) 23, 287
BstV2I GAAGAC 1 cut(s) 474
BstX2I RGATCY 2 cut(s) 149, 398
BstYI RGATCY 2 cut(s) 149, 398
BtsCI GGATG 1 cut(s) 130
BtsIMutI CAGTG 2 cut(s) 454, 462
CviAII CATG 1 cut(s) 347
CviJI RGCY 3 cut(s) 14, 23, 278
CviKI_1 RGCY 3 cut(s) 14, 23, 278
DdeI CTNAG 2 cut(s) 15, 279
DpnI GATC 4 cut(s) 151, 192, 355, 400
DpnII GATC 4 cut(s) 149, 190, 353, 398
Eco57I CTGAAG 1 cut(s) 414
Eco91I GGTNACC 1 cut(s) 62
EcoO65I GGTNACC 1 cut(s) 62
FaeI CATG 1 cut(s) 350
FaiI YATR 4 cut(s) 272, 340, 348, 431
FalI AAGNNNNNCTT 2 cut(s) 29, 61
FatI CATG 1 cut(s) 346
FbaI TGATCA 1 cut(s) 190
Fnu4HI GCNGC 2 cut(s) 12, 276
FokI GGATG 1 cut(s) 117
Fsp4HI GCNGC 2 cut(s) 12, 276
GluI GCNGC 2 cut(s) 12, 276
GsuI CTGGAG 2 cut(s) 165, 438
Hin1II CATG 1 cut(s) 350
HincII GTYRAC 1 cut(s) 425
HindII GTYRAC 1 cut(s) 425
HinfI GANTC 2 cut(s) 83, 209
HphI GGTGA 4 cut(s) 74, 200, 338, 449
Hpy166II GTNNAC 1 cut(s) 425
Hpy188I TCNGA 1 cut(s) 165
Hpy188III TCNNGA 3 cut(s) 134, 180, 206
Hpy8I GTNNAC 1 cut(s) 425
HpyAV CCTTC 1 cut(s) 389
HpyCH4III ACNGT 1 cut(s) 449
HpyCH4V TGCA 3 cut(s) 175, 342, 477
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpyF3I CTNAG 2 cut(s) 15, 279
Hsp92II CATG 1 cut(s) 350
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 4 cut(s) 149, 190, 353, 398
LmnI GCTCC 1 cut(s) 457
LpnPI CCDG 6 cut(s) 45, 129, 147, 165, 309, 468
Lsp1109I GCAGC 2 cut(s) 23, 287
MaeIII GTNAC 3 cut(s) 62, 199, 262
MalI GATC 4 cut(s) 151, 192, 355, 400
MboI GATC 4 cut(s) 149, 190, 353, 398
MboII GAAGA 2 cut(s) 309, 474
MflI RGATCY 2 cut(s) 149, 398
MhlI GDGCHC 1 cut(s) 454
MluCI AATT 4 cut(s) 138, 221, 235, 465
MmeI TCCRAC 1 cut(s) 268
MnlI CCTC 5 cut(s) 23, 33, 140, 260, 287
MseI TTAA 3 cut(s) 224, 311, 487
MslI CAYNNNNRTG 1 cut(s) 269
MspA1I CMGCKG 1 cut(s) 14
MwoI GCNNNNNNNGC 1 cut(s) 20
NdeII GATC 4 cut(s) 149, 190, 353, 398
NlaIII CATG 1 cut(s) 350
NmuCI GTSAC 3 cut(s) 62, 199, 262
PfeI GAWTC 2 cut(s) 83, 209
PkrI GCNGC 2 cut(s) 13, 277
PspEI GGTNACC 1 cut(s) 62
PsuI RGATCY 2 cut(s) 149, 398
PvuII CAGCTG 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 269
SaqAI TTAA 3 cut(s) 224, 311, 487
SatI GCNGC 2 cut(s) 12, 276
Sau3AI GATC 4 cut(s) 149, 190, 353, 398
SduI GDGCHC 1 cut(s) 454
SetI ASST 4 cut(s) 16, 44, 64, 280
SmiMI CAYNNNNRTG 1 cut(s) 269
SmlI CTYRAG 1 cut(s) 204
SmoI CTYRAG 1 cut(s) 204
Sse9I AATT 4 cut(s) 138, 221, 235, 465
TaaI ACNGT 1 cut(s) 449
TaqII GACCGA 1 cut(s) 81
TasI AATT 4 cut(s) 138, 221, 235, 465
TfiI GAWTC 2 cut(s) 83, 209
Tru1I TTAA 3 cut(s) 224, 311, 487
Tru9I TTAA 3 cut(s) 224, 311, 487
TscAI CASTG 2 cut(s) 454, 462
TseFI GTSAC 3 cut(s) 62, 199, 262
TseI GCWGC 2 cut(s) 11, 275
Tsp45I GTSAC 3 cut(s) 62, 199, 262
TspDTI ATGAA 6 cut(s) 119, 171, 183, 201, 243, 420
TspRI CASTG 2 cut(s) 454, 462
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.