Rorug07G0153400

RWP-RK domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0003038
Physical Location & Seq
Forward (+)
12172208 .. 12172736
529 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0153400.1

Sequence Viewer

Length: 411 bp
ATGGCTGAGAAGAACAACCATGCTTATCCTATAGCCCTAGCAAATGATTACGCAAGAAGTGATGGAGAGTCTTTGGTATCCGAAGATGAGCTCAAAGGCAGGAAGAGAATTAAGTTGTTTACCTATATTGGTATCCTCATTGTGTTTCAGATCATAGTCATGACAATATTTGGTCCAGACCCCCAAGGCCAGGTTGGGGGATATCAACATCTAAAGTCTCAACTCTGTCCCCGCAACACCATCGTTCGACACAAGCTTCACAACCCAAATCAGAATAAGAACACGAATTGGGGTCCATACAAGTTAGATGTAGGGACTACCATATTCATGTACCAAGGTGTGCCTGTGGGACAAGTTACTATTCTAAATTCATGTACCAAGGTGTGCCTGTGGGACAAGTTACTATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PB1 RWP-RK

Protein Analysis

136

Amino Acids

15.41

Weight (kDa)

9.2

Isoelectric Point (pI)

31.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 232
AcsI RAATTY 1 cut(s) 367
AfaI GTAC 2 cut(s) 332, 376
AfiI CCNNNNNNNGG 2 cut(s) 190, 196
AjnI CCWGG 1 cut(s) 189
AluBI AGCT 2 cut(s) 91, 256
AluI AGCT 2 cut(s) 91, 256
Alw21I GWGCWC 1 cut(s) 93
Alw26I GTCTC 1 cut(s) 222
AoxI GGCC 1 cut(s) 187
ApoI RAATTY 1 cut(s) 367
AspS9I GGNCC 2 cut(s) 173, 293
AvaII GGWCC 2 cut(s) 173, 293
BanII GRGCYC 1 cut(s) 93
Bbv12I GWGCWC 1 cut(s) 93
BccI CCATC 2 cut(s) 56, 248
BcgI CGANNNNNNTGC 2 cut(s) 223, 257
BciT130I CCWGG 1 cut(s) 191
BciVI GTATCC 2 cut(s) 88, 143
BcoDI GTCTC 1 cut(s) 222
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 30
BfuI GTATCC 2 cut(s) 88, 143
Bme1390I CCNGG 1 cut(s) 191
Bme18I GGWCC 2 cut(s) 173, 293
BmgT120I GGNCC 2 cut(s) 173, 293
BmiI GGNNCC 1 cut(s) 294
BmrFI CCNGG 1 cut(s) 191
BsaJI CCNNGG 3 cut(s) 184, 334, 378
Bsc4I CCNNNNNNNGG 2 cut(s) 190, 196
BseBI CCWGG 1 cut(s) 191
BseDI CCNNGG 3 cut(s) 184, 334, 378
BseLI CCNNNNNNNGG 2 cut(s) 190, 196
BshFI GGCC 1 cut(s) 189
BsiHKAI GWGCWC 1 cut(s) 93
BslFI GGGAC 4 cut(s) 213, 328, 363, 407
BslI CCNNNNNNNGG 2 cut(s) 190, 196
BsmAI GTCTC 1 cut(s) 222
BsmFI GGGAC 4 cut(s) 213, 328, 363, 407
BsnI GGCC 1 cut(s) 189
Bsp1286I GDGCHC 1 cut(s) 93
Bsp143I GATC 1 cut(s) 150
BspACI CCGC 1 cut(s) 232
BspANI GGCC 1 cut(s) 189
BspHI TCATGA 1 cut(s) 159
BspLI GGNNCC 1 cut(s) 294
BssECI CCNNGG 3 cut(s) 184, 334, 378
BssMI GATC 1 cut(s) 150
BssT1I CCWWGG 3 cut(s) 184, 334, 378
Bst2UI CCWGG 1 cut(s) 191
Bst6I CTCTTC 1 cut(s) 98
BstDEI CTNAG 1 cut(s) 6
BstKTI GATC 1 cut(s) 153
BstMAI GTCTC 1 cut(s) 222
BstMBI GATC 1 cut(s) 150
BstNI CCWGG 1 cut(s) 191
BstSCI CCNGG 1 cut(s) 189
BstSFI CTRYAG 1 cut(s) 30
BsuI GTATCC 2 cut(s) 88, 143
BsuRI GGCC 1 cut(s) 189
CciI TCATGA 1 cut(s) 159
Cfr13I GGNCC 2 cut(s) 173, 293
Csp6I GTAC 2 cut(s) 331, 375
CviAII CATG 4 cut(s) 20, 160, 328, 372
CviJI RGCY 5 cut(s) 5, 35, 91, 189, 256
CviKI_1 RGCY 5 cut(s) 5, 35, 91, 189, 256
CviQI GTAC 2 cut(s) 331, 375
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
Ecl136II GAGCTC 1 cut(s) 91
Eco130I CCWWGG 3 cut(s) 184, 334, 378
Eco24I GRGCYC 1 cut(s) 93
Eco32I GATATC 1 cut(s) 203
Eco47I GGWCC 2 cut(s) 173, 293
Eco53kI GAGCTC 1 cut(s) 91
EcoICRI GAGCTC 1 cut(s) 91
EcoRII CCWGG 1 cut(s) 189
EcoRV GATATC 1 cut(s) 203
EcoT14I CCWWGG 3 cut(s) 184, 334, 378
EcoT38I GRGCYC 1 cut(s) 93
ErhI CCWWGG 3 cut(s) 184, 334, 378
FaeI CATG 4 cut(s) 23, 163, 331, 375
FaiI YATR 9 cut(s) 21, 32, 126, 155, 161, 298, 323, 329, 373
FaqI GGGAC 4 cut(s) 213, 328, 363, 407
FatI CATG 4 cut(s) 19, 159, 327, 371
FauI CCCGC 1 cut(s) 239
FriOI GRGCYC 1 cut(s) 93
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 189
Hin1II CATG 4 cut(s) 23, 163, 331, 375
HindIII AAGCTT 1 cut(s) 254
HinfI GANTC 1 cut(s) 68
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 3 cut(s) 82, 150, 273
Hpy188III TCNNGA 2 cut(s) 160, 176
Hpy8I GTNNAC 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 4 cut(s) 23, 163, 331, 375
Kzo9I GATC 1 cut(s) 150
LpnPI CCDG 6 cut(s) 85, 176, 189, 203, 357, 401
MaeI CTAG 1 cut(s) 38
MaeIII GTNAC 2 cut(s) 355, 399
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 3 cut(s) 22, 95, 115
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 3 cut(s) 108, 286, 367
MlyI GAGTC 1 cut(s) 77
MnlI CCTC 1 cut(s) 146
MseI TTAA 1 cut(s) 111
MslI CAYNNNNRTG 2 cut(s) 158, 326
MspR9I CCNGG 1 cut(s) 191
MvaI CCWGG 1 cut(s) 191
NdeII GATC 1 cut(s) 150
NlaIII CATG 4 cut(s) 23, 163, 331, 375
NlaIV GGNNCC 1 cut(s) 294
PagI TCATGA 1 cut(s) 159
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
Psp124BI GAGCTC 1 cut(s) 93
Psp6I CCWGG 1 cut(s) 189
PspGI CCWGG 1 cut(s) 189
PspN4I GGNNCC 1 cut(s) 294
PspPI GGNCC 2 cut(s) 173, 293
RsaI GTAC 2 cut(s) 332, 376
RsaNI GTAC 2 cut(s) 331, 375
RseI CAYNNNNRTG 2 cut(s) 158, 326
SacI GAGCTC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 111
Sau3AI GATC 1 cut(s) 150
Sau96I GGNCC 2 cut(s) 173, 293
SchI GAGTC 1 cut(s) 77
ScrFI CCNGG 1 cut(s) 191
SduI GDGCHC 1 cut(s) 93
SetI ASST 6 cut(s) 93, 125, 195, 258, 340, 384
SfcI CTRYAG 1 cut(s) 30
SinI GGWCC 2 cut(s) 173, 293
SmiMI CAYNNNNRTG 2 cut(s) 158, 326
Sse9I AATT 3 cut(s) 108, 286, 367
SsiI CCGC 1 cut(s) 232
SspI AATATT 1 cut(s) 168
SspMI CTAG 1 cut(s) 38
SstI GAGCTC 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 189
StyI CCWWGG 3 cut(s) 184, 334, 378
TaqI TCGA 1 cut(s) 247
TasI AATT 3 cut(s) 108, 286, 367
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TspDTI ATGAA 2 cut(s) 316, 360
VpaK11BI GGWCC 2 cut(s) 173, 293
XapI RAATTY 1 cut(s) 367
XcmI CCANNNNNNNNNTGG 1 cut(s) 191
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.