Rorug07G0212700

Lipolytic acyl hydrolase (LAH)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
18800715 .. 18801981
1267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0212700.1

Sequence Viewer

Length: 228 bp
ATGTTGCTGACCAGCATGCTATCCCTCTTGACAAACCCGACGACTACCACTTCGTCTGTGGTAGAAACTTCGAACCACAGTGGTATGCTAGGACTCTCAAGGAATAAGGCCACTGCCAAGCAGGACAAAAACTTCACGTCAAGGTCACTACCAATATCAGATCACCACTTCACTGCAAGTCCAACCCCAGCACCAGAGAGTGATAATGTCCAAGTCAAAAGCATTTAA

Protein Analysis

75

Amino Acids

8.03

Weight (kDa)

8.25

Isoelectric Point (pI)

44.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjiI CACGTC 1 cut(s) 138
AoxI GGCC 1 cut(s) 108
ArsI GACNNNNNNTTYG 2 cut(s) 34, 66
AsuHPI GGTGA 1 cut(s) 155
AsuII TTCGAA 1 cut(s) 71
BfaI CTAG 1 cut(s) 89
BmgBI CACGTC 1 cut(s) 138
Bpu14I TTCGAA 1 cut(s) 71
BpuEI CTTGAG 1 cut(s) 82
BseYI CCCAGC 1 cut(s) 187
BshFI GGCC 1 cut(s) 110
BsnI GGCC 1 cut(s) 110
Bsp119I TTCGAA 1 cut(s) 71
Bsp143I GATC 1 cut(s) 160
BspANI GGCC 1 cut(s) 110
BspT104I TTCGAA 1 cut(s) 71
BssMI GATC 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 80
BstBI TTCGAA 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 17
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 19
BsuRI GGCC 1 cut(s) 110
BtrI CACGTC 1 cut(s) 138
BtsI GCAGTG 2 cut(s) 111, 171
BtsIMutI CAGTG 3 cut(s) 85, 111, 171
Cac8I GCNNGC 1 cut(s) 17
CviAII CATG 1 cut(s) 16
CviJI RGCY 1 cut(s) 110
CviKI_1 RGCY 1 cut(s) 110
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
FaeI CATG 1 cut(s) 19
FaiI YATR 2 cut(s) 17, 86
FatI CATG 1 cut(s) 15
FspBI CTAG 1 cut(s) 89
GsaI CCCAGC 1 cut(s) 191
HaeIII GGCC 1 cut(s) 110
Hin1II CATG 1 cut(s) 19
HinfI GANTC 1 cut(s) 93
HphI GGTGA 1 cut(s) 155
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 1 cut(s) 28
Hpy99I CGWCG 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4IV ACGT 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 137
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 4 cut(s) 25, 107, 201, 207
MaeI CTAG 1 cut(s) 89
MaeII ACGT 1 cut(s) 137
MaeIII GTNAC 1 cut(s) 144
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MlyI GAGTC 1 cut(s) 87
MmeI TCCRAC 1 cut(s) 206
MnlI CCTC 1 cut(s) 35
MseI TTAA 1 cut(s) 226
NdeII GATC 1 cut(s) 160
NlaIII CATG 1 cut(s) 19
NmuCI GTSAC 1 cut(s) 144
NspI RCATGY 1 cut(s) 19
NspV TTCGAA 1 cut(s) 71
PaeI GCATGC 1 cut(s) 19
PleI GAGTC 1 cut(s) 87
PpsI GAGTC 1 cut(s) 87
PspFI CCCAGC 1 cut(s) 187
SaqAI TTAA 1 cut(s) 226
Sau3AI GATC 1 cut(s) 160
SchI GAGTC 1 cut(s) 87
SetI ASST 2 cut(s) 140, 146
SfuI TTCGAA 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
SphI GCATGC 1 cut(s) 19
SspMI CTAG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 80
TaiI ACGT 1 cut(s) 140
TaqI TCGA 1 cut(s) 71
Tru1I TTAA 1 cut(s) 226
Tru9I TTAA 1 cut(s) 226
TscAI CASTG 3 cut(s) 85, 118, 178
TseFI GTSAC 1 cut(s) 144
Tsp45I GTSAC 1 cut(s) 144
TspRI CASTG 3 cut(s) 85, 118, 178
XceI RCATGY 1 cut(s) 19
XcmI CCANNNNNNNNNTGG 1 cut(s) 55
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.