Rh1AG286500

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
51533570 .. 51533875
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG286500.1

Sequence Viewer

Length: 306 bp
ATGGCTCCTGTTTACATGGCATTTCTATGTTTCATGGGGAATGAAACAGAAGCACGGAACTACACTTACAGCCTCGAGGTTGGAGGAAATGGCCGAAAGTTCATATGGGAAGGAAACCCAAGAAGCATAAGGGATAGCCACAAGAAGGTTAGGGACAGCCATGATGGCCTCATAATACAGCGCAACATGGTGCTTTTCTTCTCTGGTGGGGATAGGAAAGAGCTGAAGCTACGAGTTACAGGGCGGATATGGAAAGAACAGCAGAACCCAGAAGGCGGTGCCTGCATCATACCACTCTGTAGTTAG

Protein Analysis

101

Amino Acids

11.54

Weight (kDa)

9.18

Isoelectric Point (pI)

37.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sina_TRAF PF03145 2 - 80 3.7e-26 Sina, TRAF-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 74
AccB1I GGYRCC 1 cut(s) 278
AciI CCGC 2 cut(s) 244, 276
AcoI YGGCCR 1 cut(s) 91
AcuI CTGAAG 1 cut(s) 245
AfiI CCNNNNNNNGG 2 cut(s) 145, 275
AluBI AGCT 2 cut(s) 223, 229
AluI AGCT 2 cut(s) 223, 229
Ama87I CYCGRG 1 cut(s) 74
AoxI GGCC 2 cut(s) 91, 166
AspLEI GCGC 1 cut(s) 183
AvaI CYCGRG 1 cut(s) 74
BanI GGYRCC 1 cut(s) 278
BccI CCATC 1 cut(s) 158
BfmI CTRYAG 1 cut(s) 298
BglI GCCNNNNNGGC 1 cut(s) 165
BmeT110I CYCGRG 1 cut(s) 74
BmiI GGNNCC 2 cut(s) 6, 280
BmsI GCATC 1 cut(s) 294
Bsc4I CCNNNNNNNGG 2 cut(s) 145, 275
BseLI CCNNNNNNNGG 2 cut(s) 145, 275
BshFI GGCC 2 cut(s) 93, 168
BshNI GGYRCC 1 cut(s) 278
BsiHKCI CYCGRG 1 cut(s) 74
BslFI GGGAC 1 cut(s) 167
BslI CCNNNNNNNGG 2 cut(s) 145, 275
BsmFI GGGAC 1 cut(s) 167
BsnI GGCC 2 cut(s) 93, 168
BsoBI CYCGRG 1 cut(s) 74
BspACI CCGC 2 cut(s) 244, 276
BspANI GGCC 2 cut(s) 93, 168
BspLI GGNNCC 2 cut(s) 6, 280
BspT107I GGYRCC 1 cut(s) 278
BstC8I GCNNGC 1 cut(s) 283
BstHHI GCGC 1 cut(s) 183
BstMWI GCNNNNNNNGC 2 cut(s) 165, 282
BstSFI CTRYAG 1 cut(s) 298
BsuRI GGCC 2 cut(s) 93, 168
Cac8I GCNNGC 1 cut(s) 283
CfoI GCGC 1 cut(s) 183
CviAII CATG 4 cut(s) 16, 34, 161, 187
CviJI RGCY 8 cut(s) 5, 72, 93, 138, 159, 168, 223, 229
CviKI_1 RGCY 8 cut(s) 5, 72, 93, 138, 159, 168, 223, 229
EaeI YGGCCR 1 cut(s) 91
EciI GGCGGA 1 cut(s) 259
Eco57I CTGAAG 1 cut(s) 245
Eco88I CYCGRG 1 cut(s) 74
FaeI CATG 4 cut(s) 19, 37, 164, 190
FaqI GGGAC 1 cut(s) 167
FatI CATG 4 cut(s) 15, 33, 160, 186
FauNDI CATATG 1 cut(s) 104
GlaI GCGC 1 cut(s) 182
HaeIII GGCC 2 cut(s) 93, 168
HhaI GCGC 1 cut(s) 183
Hin1II CATG 4 cut(s) 19, 37, 164, 190
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 3 cut(s) 104, 139, 266
HpyCH4V TGCA 1 cut(s) 285
HpyF10VI GCNNNNNNNGC 2 cut(s) 165, 282
Hsp92II CATG 4 cut(s) 19, 37, 164, 190
HspAI GCGC 1 cut(s) 181
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 5 cut(s) 21, 189, 225, 282, 295
LweI GCATC 1 cut(s) 294
MaeIII GTNAC 1 cut(s) 235
MboII GAAGA 1 cut(s) 190
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 4 cut(s) 70, 77, 83, 179
MslI CAYNNNNRTG 1 cut(s) 25
MwoI GCNNNNNNNGC 2 cut(s) 165, 282
NdeI CATATG 1 cut(s) 104
NlaIII CATG 4 cut(s) 19, 37, 164, 190
NlaIV GGNNCC 2 cut(s) 6, 280
PaeR7I CTCGAG 1 cut(s) 74
PspN4I GGNNCC 2 cut(s) 6, 280
PspXI VCTCGAGB 1 cut(s) 74
PsrI GAACNNNNNNTAC 2 cut(s) 50, 82
RseI CAYNNNNRTG 1 cut(s) 25
SetI ASST 4 cut(s) 81, 150, 225, 231
SfaNI GCATC 1 cut(s) 294
SfcI CTRYAG 1 cut(s) 298
Sfr274I CTCGAG 1 cut(s) 74
SlaI CTCGAG 1 cut(s) 74
SmiMI CAYNNNNRTG 1 cut(s) 25
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SsiI CCGC 2 cut(s) 244, 276
TaqI TCGA 1 cut(s) 75
TspDTI ATGAA 3 cut(s) 22, 57, 91
TspGWI ACGGA 1 cut(s) 70
XhoI CTCGAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.