Rh1BG252300

E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of target proteins. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin- conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0009759
Physical Location & Seq
Reverse (-)
38126209 .. 38126382
174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG252300.1

Sequence Viewer

Length: 174 bp
ATGGCTCCTGTTTACATGGCATTTCTACGTTTCATGGGGGATGAAACAGAAGCTCGGAACTACACCTACAGCCTCGAGGTTGGAGGAAATGGCCGAAAGATCATATGGGAAGGAAATCCAAGAAACATAAGGGATAGCCACAAGAAGGTTAGGACAGCCATGATGGCTTCATAA

Protein Analysis

57

Amino Acids

6.57

Weight (kDa)

9.69

Isoelectric Point (pI)

44.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sina_TRAF PF03145 2 - 52 2e-17 Sina, TRAF-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 74
AcoI YGGCCR 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 145
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
Ama87I CYCGRG 1 cut(s) 74
AoxI GGCC 1 cut(s) 91
AvaI CYCGRG 1 cut(s) 74
BccI CCATC 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 67
BglI GCCNNNNNGGC 1 cut(s) 164
BmeT110I CYCGRG 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 145
BseGI GGATG 1 cut(s) 46
BseLI CCNNNNNNNGG 1 cut(s) 145
BshFI GGCC 1 cut(s) 93
BsiHKCI CYCGRG 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 145
BsnI GGCC 1 cut(s) 93
BsoBI CYCGRG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 99
BspANI GGCC 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 6
BssMI GATC 1 cut(s) 99
BstF5I GGATG 1 cut(s) 46
BstKTI GATC 1 cut(s) 102
BstMBI GATC 1 cut(s) 99
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstSFI CTRYAG 1 cut(s) 67
BsuRI GGCC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 46
CviAII CATG 3 cut(s) 16, 34, 160
CviJI RGCY 7 cut(s) 5, 53, 72, 93, 138, 158, 167
CviKI_1 RGCY 7 cut(s) 5, 53, 72, 93, 138, 158, 167
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
EaeI YGGCCR 1 cut(s) 91
Eco88I CYCGRG 1 cut(s) 74
FaeI CATG 3 cut(s) 19, 37, 163
FaiI YATR 7 cut(s) 17, 35, 104, 106, 128, 161, 172
FatI CATG 3 cut(s) 15, 33, 159
FauNDI CATATG 1 cut(s) 104
FokI GGATG 1 cut(s) 53
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 3 cut(s) 19, 37, 163
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 57
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 2 cut(s) 104, 139
HpyCH4IV ACGT 1 cut(s) 28
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpySE526I ACGT 1 cut(s) 28
Hsp92II CATG 3 cut(s) 19, 37, 163
Kzo9I GATC 1 cut(s) 99
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 1 cut(s) 21
MaeII ACGT 1 cut(s) 28
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 3 cut(s) 70, 77, 83
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeI CATATG 1 cut(s) 104
NdeII GATC 1 cut(s) 99
NlaIII CATG 3 cut(s) 19, 37, 163
NlaIV GGNNCC 1 cut(s) 6
PaeR7I CTCGAG 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 6
PspXI VCTCGAGB 1 cut(s) 74
PsrI GAACNNNNNNTAC 2 cut(s) 50, 82
Sau3AI GATC 1 cut(s) 99
SetI ASST 5 cut(s) 31, 55, 68, 81, 150
SfcI CTRYAG 1 cut(s) 67
Sfr274I CTCGAG 1 cut(s) 74
SgeI CNNG 8 cut(s) 20, 28, 46, 66, 86, 88, 132, 154
SlaI CTCGAG 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
TaiI ACGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 75
TspDTI ATGAA 3 cut(s) 22, 57, 159
XhoI CTCGAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.