Rh1CG443500

BLOC-1-related complex sub-unit 8

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0006704
Physical Location & Seq
Forward (+)
69580752 .. 69581505
754 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG443500.1

Sequence Viewer

Length: 291 bp
ATGCATGGATTCTCCACCGTCGACGGCTTTGTGGAGATAACTGAATGCTTGGGAGAGATGATTAAGTATGTGGCAAACGAACCCTCAGAGGGGCTTTATTATGTTCAGCAGCACACTCAAAATGCCTTGCCCAATCTCGTTGGTCTCAGAAATAATGTTGTGAACAAGTCGCGTGAAACAACTTTGCACACTGAAGATTCTGAGGATTCCATAATCATGAAAACTTTGATGAGTTCAAGGCTGATAAAGAAGTTAAACTACGAGAGTGGTTGGAAGGGACCGACAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BORCS8

Protein Analysis

96

Amino Acids

10.85

Weight (kDa)

5.52

Isoelectric Point (pI)

58.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BORCS8 PF10167 5 - 76 2.6e-20 BLOC-1-related complex sub-unit 8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 21
AccII CGCG 1 cut(s) 172
AcuI CTGAAG 1 cut(s) 213
AfiI CCNNNNNNNGG 2 cut(s) 89, 90
AgsI TTSAA 1 cut(s) 237
Alw26I GTCTC 1 cut(s) 149
ApeKI GCWGC 1 cut(s) 109
AspS9I GGNCC 1 cut(s) 278
AvaII GGWCC 1 cut(s) 278
BarI GAAGNNNNNNTAC 2 cut(s) 242, 274
BbvI GCAGC 1 cut(s) 121
BceAI ACGGC 1 cut(s) 40
BcoDI GTCTC 1 cut(s) 149
BfaI CTAG 1 cut(s) 289
BisI GCNGC 1 cut(s) 110
BlsI GCNGC 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 278
BmgT120I GGNCC 1 cut(s) 278
BmiI GGNNCC 1 cut(s) 279
BsaI GGTCTC 1 cut(s) 149
Bsc4I CCNNNNNNNGG 2 cut(s) 89, 90
BseLI CCNNNNNNNGG 2 cut(s) 89, 90
BseMII CTCAG 3 cut(s) 99, 160, 192
BseXI GCAGC 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 172
BslI CCNNNNNNNGG 2 cut(s) 89, 90
BsmAI GTCTC 1 cut(s) 149
BsmI GAATGC 1 cut(s) 50
Bso31I GGTCTC 1 cut(s) 149
BspCNI CTCAG 3 cut(s) 98, 159, 193
BspFNI CGCG 1 cut(s) 172
BspHI TCATGA 1 cut(s) 216
BspLI GGNNCC 1 cut(s) 279
BspTNI GGTCTC 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 19
BstDEI CTNAG 3 cut(s) 85, 146, 201
BstFNI CGCG 1 cut(s) 172
BstMAI GTCTC 1 cut(s) 149
BstUI CGCG 1 cut(s) 172
BstV1I GCAGC 1 cut(s) 121
BtsIMutI CAGTG 1 cut(s) 189
CciI TCATGA 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 278
CviAII CATG 2 cut(s) 5, 217
CviJI RGCY 3 cut(s) 27, 94, 241
CviKI_1 RGCY 3 cut(s) 27, 94, 241
DdeI CTNAG 3 cut(s) 85, 146, 201
Eco31I GGTCTC 1 cut(s) 149
Eco47I GGWCC 1 cut(s) 278
Eco57I CTGAAG 1 cut(s) 213
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 220
FaiI YATR 5 cut(s) 6, 69, 102, 212, 218
FatI CATG 2 cut(s) 4, 216
FblI GTMKAC 1 cut(s) 21
Fnu4HI GCNGC 1 cut(s) 110
Fsp4HI GCNGC 1 cut(s) 110
FspBI CTAG 1 cut(s) 289
GluI GCNGC 1 cut(s) 110
Hin1II CATG 2 cut(s) 8, 220
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 3 cut(s) 9, 197, 206
Hpy166II GTNNAC 2 cut(s) 22, 163
Hpy188I TCNGA 3 cut(s) 88, 149, 202
Hpy188III TCNNGA 1 cut(s) 217
Hpy8I GTNNAC 2 cut(s) 22, 163
Hpy99I CGWCG 2 cut(s) 23, 26
HpyAV CCTTC 1 cut(s) 268
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 4, 187
HpyF3I CTNAG 3 cut(s) 85, 146, 201
Hsp92II CATG 2 cut(s) 8, 220
Lsp1109I GCAGC 1 cut(s) 121
MaeI CTAG 1 cut(s) 289
MboII GAAGA 1 cut(s) 206
MmeI TCCRAC 1 cut(s) 251
MnlI CCTC 3 cut(s) 82, 94, 196
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 63, 254
MslI CAYNNNNRTG 1 cut(s) 215
Mva1269I GAATGC 1 cut(s) 50
MvnI CGCG 1 cut(s) 172
NlaIII CATG 2 cut(s) 8, 220
NlaIV GGNNCC 1 cut(s) 279
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 216
PctI GAATGC 1 cut(s) 50
PfeI GAWTC 3 cut(s) 9, 197, 206
PkrI GCNGC 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 279
PspPI GGNCC 1 cut(s) 278
RseI CAYNNNNRTG 1 cut(s) 215
SalI GTCGAC 1 cut(s) 20
SaqAI TTAA 2 cut(s) 63, 254
SatI GCNGC 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 278
SgrDI CGTCGACG 1 cut(s) 20
SinI GGWCC 1 cut(s) 278
SmiMI CAYNNNNRTG 1 cut(s) 215
SspMI CTAG 1 cut(s) 289
TaaI ACNGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 21
TfiI GAWTC 3 cut(s) 9, 197, 206
Tru1I TTAA 2 cut(s) 63, 254
Tru9I TTAA 2 cut(s) 63, 254
TscAI CASTG 1 cut(s) 196
TseI GCWGC 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 233
TspRI CASTG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 278
XmiI GTMKAC 1 cut(s) 21
XspI CTAG 1 cut(s) 289
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.