Rh1DG111600

Stomatin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0008169
Physical Location & Seq
Forward (+)
20526342 .. 20527730
1389 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG111600.1

Sequence Viewer

Length: 474 bp
ATGTTTAAGCCTACATCCCTTAACGGGTTGAGATCTCTATGGCACCTCAACCATTCCTCATCTGCCAGCTCTTGGTTTTCCCAGTTCTCTCCGTCGTCGTCTTCGTTTGCTCGATCGGACAGTTTCCTGACCGTTCGAAATTACGCCAGCAGTGTCGATGACAGAAATCATATCACTCCAGGGACTCGTCGAGTTCTGGTACCTCCCAGGCAGGCTGTTGTCATTAAGCGGTGGTTTGGAATGTACTCCAAGACCCTGTTATCTGGAGAATATTTCTTAATTCCGTATTTTGATAAAATTGCTTCTGTGCATTGCTTGAAACCCAAGACCATAAATCTTCTGGCCCAGAAAGCTATCACCAAAAACAATGTGGGCCTTACTGTTACTAGCCAGTTAACTCTCAAGATTTTGGAGCCTATGTTAGCTACTTATGCGGTCGACAATCCCATTGATAAGGCTATTGGTCTTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006996 GO:0007005 GO:0007006 GO:0008150 GO:0009987 GO:0016043 GO:0061024 GO:0071840
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Band_7 Band_7_C

Protein Analysis

157

Amino Acids

17.51

Weight (kDa)

10.06

Isoelectric Point (pI)

49.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Band_7 PF01145 67 - 142 1.1e-07 SPFH domain / Band 7 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 199
AccB1I GGYRCC 2 cut(s) 42, 199
AccB7I CCANNNNNTGG 1 cut(s) 72
AccI GTMKAC 1 cut(s) 438
AciI CCGC 2 cut(s) 229, 434
AfaI GTAC 2 cut(s) 201, 245
AfiI CCNNNNNNNGG 2 cut(s) 24, 72
AgsI TTSAA 1 cut(s) 319
AjnI CCWGG 2 cut(s) 178, 206
AluBI AGCT 3 cut(s) 69, 353, 425
AluI AGCT 3 cut(s) 69, 353, 425
AoxI GGCC 2 cut(s) 342, 373
Asp718I GGTACC 1 cut(s) 199
AspS9I GGNCC 2 cut(s) 343, 373
AsuHPI GGTGA 1 cut(s) 349
AsuII TTCGAA 1 cut(s) 136
BanI GGYRCC 2 cut(s) 42, 199
BbsI GAAGAC 1 cut(s) 93
BciT130I CCWGG 2 cut(s) 180, 208
BfaI CTAG 1 cut(s) 387
BglII AGATCT 1 cut(s) 32
Bme1390I CCNGG 2 cut(s) 180, 208
BmgT120I GGNCC 2 cut(s) 343, 373
BmiI GGNNCC 3 cut(s) 44, 201, 414
BmrFI CCNGG 2 cut(s) 180, 208
BmrI ACTGGG 1 cut(s) 76
BmuI ACTGGG 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 93
BpmI CTGGAG 2 cut(s) 162, 285
Bpu14I TTCGAA 1 cut(s) 136
BpuEI CTTGAG 1 cut(s) 386
BsaJI CCNNGG 2 cut(s) 179, 206
BsaXI ACNNNNNCTCC 2 cut(s) 404, 434
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 72
Bse1I ACTGG 2 cut(s) 82, 391
Bse3DI GCAATG 1 cut(s) 310
BseBI CCWGG 2 cut(s) 180, 208
BseDI CCNNGG 2 cut(s) 179, 206
BseGI GGATG 1 cut(s) 14
BseLI CCNNNNNNNGG 2 cut(s) 24, 72
BseMI GCAATG 1 cut(s) 310
BseNI ACTGG 2 cut(s) 82, 391
Bsh1285I CGRYCG 2 cut(s) 116, 438
BshFI GGCC 2 cut(s) 344, 375
BshNI GGYRCC 2 cut(s) 42, 199
BsiEI CGRYCG 2 cut(s) 116, 438
BslFI GGGAC 1 cut(s) 196
BslI CCNNNNNNNGG 2 cut(s) 24, 72
BsmFI GGGAC 1 cut(s) 196
BsnI GGCC 2 cut(s) 344, 375
Bsp119I TTCGAA 1 cut(s) 136
Bsp143I GATC 2 cut(s) 32, 113
BspACI CCGC 2 cut(s) 229, 434
BspANI GGCC 2 cut(s) 344, 375
BspLI GGNNCC 3 cut(s) 44, 201, 414
BspT104I TTCGAA 1 cut(s) 136
BspT107I GGYRCC 2 cut(s) 42, 199
BsrDI GCAATG 1 cut(s) 310
BsrI ACTGG 2 cut(s) 82, 391
BssECI CCNNGG 2 cut(s) 179, 206
BssMI GATC 2 cut(s) 32, 113
Bst2UI CCWGG 2 cut(s) 180, 208
Bst4CI ACNGT 3 cut(s) 122, 133, 382
BstBI TTCGAA 1 cut(s) 136
BstC8I GCNNGC 3 cut(s) 67, 148, 213
BstDEI CTNAG 1 cut(s) 471
BstF5I GGATG 1 cut(s) 14
BstKTI GATC 2 cut(s) 35, 116
BstMBI GATC 2 cut(s) 32, 113
BstMCI CGRYCG 2 cut(s) 116, 438
BstMWI GCNNNNNNNGC 2 cut(s) 350, 431
BstNI CCWGG 2 cut(s) 180, 208
BstSCI CCNGG 2 cut(s) 178, 206
BstV2I GAAGAC 1 cut(s) 93
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 2 cut(s) 344, 375
BtsCI GGATG 1 cut(s) 14
BtsI GCAGTG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 157
Cac8I GCNNGC 3 cut(s) 67, 148, 213
Cfr13I GGNCC 2 cut(s) 343, 373
Csp6I GTAC 2 cut(s) 200, 244
CviQI GTAC 2 cut(s) 200, 244
DdeI CTNAG 1 cut(s) 471
DpnI GATC 2 cut(s) 34, 115
DpnII GATC 2 cut(s) 32, 113
EcoRII CCWGG 2 cut(s) 178, 206
FaiI YATR 5 cut(s) 40, 171, 332, 419, 432
FaqI GGGAC 1 cut(s) 196
FblI GTMKAC 1 cut(s) 438
FspBI CTAG 1 cut(s) 387
GsuI CTGGAG 2 cut(s) 162, 285
HaeIII GGCC 2 cut(s) 344, 375
HincII GTYRAC 2 cut(s) 396, 439
HindII GTYRAC 2 cut(s) 396, 439
HinfI GANTC 1 cut(s) 184
HpaI GTTAAC 1 cut(s) 396
HphI GGTGA 1 cut(s) 349
Hpy166II GTNNAC 2 cut(s) 396, 439
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 3 cut(s) 127, 264, 403
Hpy8I GTNNAC 2 cut(s) 396, 439
Hpy99I CGWCG 3 cut(s) 97, 100, 192
HpyCH4III ACNGT 3 cut(s) 122, 133, 382
HpyCH4V TGCA 1 cut(s) 310
HpyF10VI GCNNNNNNNGC 2 cut(s) 350, 431
HpyF3I CTNAG 1 cut(s) 471
KpnI GGTACC 1 cut(s) 203
KspAI GTTAAC 1 cut(s) 396
Kzo9I GATC 2 cut(s) 32, 113
LmnI GCTCC 1 cut(s) 412
MaeI CTAG 1 cut(s) 387
MaeIII GTNAC 1 cut(s) 382
MalI GATC 2 cut(s) 34, 115
MboI GATC 2 cut(s) 32, 113
MboII GAAGA 2 cut(s) 93, 329
MflI RGATCY 1 cut(s) 32
MluCI AATT 3 cut(s) 139, 279, 297
MlyI GAGTC 1 cut(s) 178
MnlI CCTC 3 cut(s) 56, 67, 213
MseI TTAA 5 cut(s) 6, 21, 225, 278, 395
MspR9I CCNGG 2 cut(s) 180, 208
MvaI CCWGG 2 cut(s) 180, 208
MwoI GCNNNNNNNGC 2 cut(s) 350, 431
NdeII GATC 2 cut(s) 32, 113
NlaIV GGNNCC 3 cut(s) 44, 201, 414
NspV TTCGAA 1 cut(s) 136
PcsI WCGNNNNNNNCGW 1 cut(s) 101
PflMI CCANNNNNTGG 1 cut(s) 72
Ple19I CGATCG 1 cut(s) 116
PleI GAGTC 1 cut(s) 178
PpsI GAGTC 1 cut(s) 178
Psp6I CCWGG 2 cut(s) 178, 206
PspGI CCWGG 2 cut(s) 178, 206
PspN4I GGNNCC 3 cut(s) 44, 201, 414
PspPI GGNCC 2 cut(s) 343, 373
PsuI RGATCY 1 cut(s) 32
PvuI CGATCG 1 cut(s) 116
RsaI GTAC 2 cut(s) 201, 245
RsaNI GTAC 2 cut(s) 200, 244
SalI GTCGAC 1 cut(s) 437
SaqAI TTAA 5 cut(s) 6, 21, 225, 278, 395
Sau3AI GATC 2 cut(s) 32, 113
Sau96I GGNCC 2 cut(s) 343, 373
SchI GAGTC 1 cut(s) 178
ScrFI CCNGG 2 cut(s) 180, 208
SetI ASST 5 cut(s) 48, 71, 205, 355, 427
SfuI TTCGAA 1 cut(s) 136
SmlI CTYRAG 1 cut(s) 401
SmoI CTYRAG 1 cut(s) 401
Sse9I AATT 3 cut(s) 139, 279, 297
SsiI CCGC 2 cut(s) 229, 434
SspI AATATT 1 cut(s) 272
SspMI CTAG 1 cut(s) 387
StyD4I CCNGG 2 cut(s) 178, 206
TaaI ACNGT 3 cut(s) 122, 133, 382
TaqI TCGA 5 cut(s) 112, 136, 156, 190, 438
TasI AATT 3 cut(s) 139, 279, 297
TatI WGTACW 1 cut(s) 243
Tru1I TTAA 5 cut(s) 6, 21, 225, 278, 395
Tru9I TTAA 5 cut(s) 6, 21, 225, 278, 395
TscAI CASTG 1 cut(s) 157
TspGWI ACGGA 2 cut(s) 81, 273
TspRI CASTG 1 cut(s) 157
Van91I CCANNNNNTGG 1 cut(s) 72
XcmI CCANNNNNNNNNTGG 2 cut(s) 337, 367
XmiI GTMKAC 1 cut(s) 438
XspI CTAG 1 cut(s) 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.