Rh2AG248000

Xyloglucan galactosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
27893935 .. 27894495
561 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG248000.1

Sequence Viewer

Length: 240 bp
ATGGCAAAACAAGATGCGAGCGCGTACTCTATGTTCTTAGACCAGAAGAGTAATGCGAGTAAGAGAATTGAAGAAGAGTTGTTGAAGATTTCGAGCGACAGGGTTGAGAGGATGCGTGAAAAGCTTATAGACTTGATTCCGAGCTTGACTTACGCCCACCCTAATGCGTCAAGTATAGGGTTTGAGGATGTTGCACTTGCATCATTGACCAATAAGCATGTCAACAAAATTATAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.89

Weight (kDa)

6.72

Isoelectric Point (pI)

43.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 233
AccII CGCG 1 cut(s) 23
AfaI GTAC 1 cut(s) 26
AgsI TTSAA 2 cut(s) 71, 85
AluBI AGCT 2 cut(s) 124, 144
AluI AGCT 2 cut(s) 124, 144
AspLEI GCGC 1 cut(s) 23
BmsI GCATC 3 cut(s) 4, 102, 209
BseGI GGATG 2 cut(s) 117, 193
Bsh1236I CGCG 1 cut(s) 23
BspFNI CGCG 1 cut(s) 23
Bst6I CTCTTC 2 cut(s) 41, 69
BstC8I GCNNGC 1 cut(s) 19
BstDEI CTNAG 1 cut(s) 37
BstF5I GGATG 2 cut(s) 117, 193
BstFNI CGCG 1 cut(s) 23
BstHHI GCGC 1 cut(s) 23
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNSI RCATGY 1 cut(s) 221
BstUI CGCG 1 cut(s) 23
BtsCI GGATG 2 cut(s) 117, 193
Cac8I GCNNGC 1 cut(s) 19
CfoI GCGC 1 cut(s) 23
CseI GACGC 1 cut(s) 156
Csp6I GTAC 1 cut(s) 25
CviAII CATG 1 cut(s) 218
CviJI RGCY 2 cut(s) 124, 144
CviKI_1 RGCY 2 cut(s) 124, 144
CviQI GTAC 1 cut(s) 25
DdeI CTNAG 1 cut(s) 37
Eam1104I CTCTTC 2 cut(s) 41, 69
EarI CTCTTC 2 cut(s) 41, 69
FaeI CATG 1 cut(s) 221
FaiI YATR 5 cut(s) 32, 128, 176, 219, 233
FatI CATG 1 cut(s) 217
FokI GGATG 2 cut(s) 124, 200
GlaI GCGC 1 cut(s) 22
HgaI GACGC 1 cut(s) 156
HhaI GCGC 1 cut(s) 23
Hin1II CATG 1 cut(s) 221
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HindIII AAGCTT 1 cut(s) 122
HinfI GANTC 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 223
Hpy188I TCNGA 1 cut(s) 141
Hpy8I GTNNAC 1 cut(s) 223
HpyCH4V TGCA 2 cut(s) 194, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpyF3I CTNAG 1 cut(s) 37
Hsp92II CATG 1 cut(s) 221
HspAI GCGC 1 cut(s) 21
LpnPI CCDG 2 cut(s) 56, 85
LweI GCATC 3 cut(s) 4, 102, 209
MboII GAAGA 4 cut(s) 58, 83, 86, 97
MluCI AATT 3 cut(s) 66, 228, 235
MnlI CCTC 2 cut(s) 102, 178
MseI TTAA 1 cut(s) 238
MslI CAYNNNNRTG 1 cut(s) 162
MvnI CGCG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 121
NlaIII CATG 1 cut(s) 221
NspI RCATGY 1 cut(s) 221
PfeI GAWTC 1 cut(s) 136
PsiI TTATAA 1 cut(s) 233
PsrI GAACNNNNNNTAC 2 cut(s) 17, 49
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
RseI CAYNNNNRTG 1 cut(s) 162
SaqAI TTAA 1 cut(s) 238
SetI ASST 2 cut(s) 126, 146
SfaNI GCATC 3 cut(s) 4, 102, 209
SmiMI CAYNNNNRTG 1 cut(s) 162
Sse9I AATT 3 cut(s) 66, 228, 235
TaqI TCGA 1 cut(s) 92
TasI AATT 3 cut(s) 66, 228, 235
TfiI GAWTC 1 cut(s) 136
Tru1I TTAA 1 cut(s) 238
Tru9I TTAA 1 cut(s) 238
XceI RCATGY 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.