Rh2BG374300

Exosome complex component

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
52794970 .. 52795222
253 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG374300.1

Sequence Viewer

Length: 180 bp
ATGGCCGACCCTTCCTTTGAGCTTGGCTGCCCTGGCGAGTCAGTCATCGAGCTTGGCTGCGTTATTGACTGCGGTCTCAAGGAGAGCAGGGCAGTTGATACAGAGTCGCTTTGTATTCTTTCTAGCAAGTTGGTGTGGGCTATACGTGTTGACCTCCGCATTCTAGATAATGGAGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.3

Weight (kDa)

4.28

Isoelectric Point (pI)

37.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 72, 157
AcoI YGGCCR 1 cut(s) 3
AflIII ACRYGT 1 cut(s) 145
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 2 cut(s) 22, 52
AluI AGCT 2 cut(s) 22, 52
Alw26I GTCTC 1 cut(s) 80
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 27, 57
ArsI GACNNNNNNTTYG 1 cut(s) 31
BbvI GCAGC 2 cut(s) 14, 44
BciT130I CCWGG 1 cut(s) 33
BcoDI GTCTC 1 cut(s) 80
BfaI CTAG 2 cut(s) 123, 164
BisI GCNGC 2 cut(s) 28, 58
BlsI GCNGC 2 cut(s) 29, 59
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BoxI GACNNNNGTC 1 cut(s) 72
BpuEI CTTGAG 1 cut(s) 62
BsaAI YACGTR 1 cut(s) 146
BsaI GGTCTC 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 31
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 31
BseXI GCAGC 2 cut(s) 14, 44
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 80
BsmI GAATGC 1 cut(s) 159
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 80
BspACI CCGC 2 cut(s) 72, 157
BspANI GGCC 1 cut(s) 5
BspTNI GGTCTC 1 cut(s) 80
BssECI CCNNGG 1 cut(s) 31
Bst2UI CCWGG 1 cut(s) 33
BstBAI YACGTR 1 cut(s) 146
BstMAI GTCTC 1 cut(s) 80
BstMWI GCNNNNNNNGC 1 cut(s) 33
BstNI CCWGG 1 cut(s) 33
BstPAI GACNNNNGTC 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 31
BstV1I GCAGC 2 cut(s) 14, 44
BsuRI GGCC 1 cut(s) 5
CviJI RGCY 6 cut(s) 5, 22, 27, 52, 57, 140
CviKI_1 RGCY 6 cut(s) 5, 22, 27, 52, 57, 140
EaeI YGGCCR 1 cut(s) 3
Eco31I GGTCTC 1 cut(s) 80
EcoRII CCWGG 1 cut(s) 31
FaiI YATR 1 cut(s) 143
Fnu4HI GCNGC 2 cut(s) 28, 58
Fsp4HI GCNGC 2 cut(s) 28, 58
FspBI CTAG 2 cut(s) 123, 164
GluI GCNGC 2 cut(s) 28, 58
HaeIII GGCC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 151
HindII GTYRAC 1 cut(s) 151
HinfI GANTC 2 cut(s) 38, 104
Hpy166II GTNNAC 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 164
Hpy8I GTNNAC 1 cut(s) 151
HpyAV CCTTC 1 cut(s) 21
HpyCH4IV ACGT 1 cut(s) 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 145
LpnPI CCDG 3 cut(s) 18, 45, 73
Lsp1109I GCAGC 2 cut(s) 14, 44
MaeI CTAG 2 cut(s) 123, 164
MaeII ACGT 1 cut(s) 145
MlyI GAGTC 2 cut(s) 47, 113
MnlI CCTC 2 cut(s) 164, 167
MspR9I CCNGG 1 cut(s) 33
Mva1269I GAATGC 1 cut(s) 159
MvaI CCWGG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 33
PctI GAATGC 1 cut(s) 159
PkrI GCNGC 2 cut(s) 29, 59
PleI GAGTC 2 cut(s) 46, 112
PpsI GAGTC 2 cut(s) 46, 112
Ppu21I YACGTR 1 cut(s) 146
PshAI GACNNNNGTC 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
SatI GCNGC 2 cut(s) 28, 58
SchI GAGTC 2 cut(s) 47, 113
ScrFI CCNGG 1 cut(s) 33
SetI ASST 4 cut(s) 24, 54, 148, 156
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
SsiI CCGC 2 cut(s) 72, 157
SspMI CTAG 2 cut(s) 123, 164
StyD4I CCNGG 1 cut(s) 31
TaiI ACGT 1 cut(s) 148
TaqI TCGA 1 cut(s) 48
TseI GCWGC 2 cut(s) 27, 57
XbaI TCTAGA 1 cut(s) 163
XspI CTAG 2 cut(s) 123, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.