Rh2DG094800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
7442898 .. 7443047
150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG094800.1

Sequence Viewer

Length: 150 bp
ATGACGAAGAAGAGGAGTCAGCGCATTGCCAAGGTTCAAGAGGAGTCCATGGCCAATGCTGAAAAAATTGCAGAGATTAAGGCTAAAGACTTTGATGAGAAGATGAAGAACAAGTATGGACAGAGGGTTAAGCCTGAGTTTGAAGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.76

Weight (kDa)

9.57

Isoelectric Point (pI)

56.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 51
AgsI TTSAA 2 cut(s) 38, 143
AoxI GGCC 1 cut(s) 51
AspLEI GCGC 1 cut(s) 24
BalI TGGCCA 1 cut(s) 53
BsaJI CCNNGG 2 cut(s) 30, 48
Bse3DI GCAATG 1 cut(s) 24
BseDI CCNNGG 2 cut(s) 30, 48
BseMI GCAATG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 126
BseRI GAGGAG 2 cut(s) 28, 56
BshFI GGCC 1 cut(s) 53
BsnI GGCC 1 cut(s) 53
Bsp19I CCATGG 1 cut(s) 48
BspANI GGCC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 24
BssECI CCNNGG 2 cut(s) 30, 48
BssT1I CCWWGG 2 cut(s) 30, 48
Bst6I CTCTTC 1 cut(s) 5
BstDEI CTNAG 1 cut(s) 135
BstDSI CCRYGG 1 cut(s) 48
BstHHI GCGC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 53
BtgI CCRYGG 1 cut(s) 48
CfoI GCGC 1 cut(s) 24
CviAII CATG 1 cut(s) 49
CviJI RGCY 4 cut(s) 53, 83, 133, 146
CviKI_1 RGCY 4 cut(s) 53, 83, 133, 146
DdeI CTNAG 1 cut(s) 135
EaeI YGGCCR 1 cut(s) 51
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco130I CCWWGG 2 cut(s) 30, 48
EcoT14I CCWWGG 2 cut(s) 30, 48
ErhI CCWWGG 2 cut(s) 30, 48
FaeI CATG 1 cut(s) 52
FaiI YATR 2 cut(s) 50, 117
FatI CATG 1 cut(s) 48
GlaI GCGC 1 cut(s) 23
HaeIII GGCC 1 cut(s) 53
HhaI GCGC 1 cut(s) 24
Hin1II CATG 1 cut(s) 52
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
HinfI GANTC 2 cut(s) 16, 44
Hpy188III TCNNGA 1 cut(s) 38
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 135
Hsp92II CATG 1 cut(s) 52
HspAI GCGC 1 cut(s) 22
MboII GAAGA 4 cut(s) 19, 22, 112, 118
MlsI TGGCCA 1 cut(s) 53
MluCI AATT 1 cut(s) 66
MluNI TGGCCA 1 cut(s) 53
MlyI GAGTC 2 cut(s) 25, 53
MnlI CCTC 3 cut(s) 6, 34, 117
Mox20I TGGCCA 1 cut(s) 53
MscI TGGCCA 1 cut(s) 53
MseI TTAA 2 cut(s) 78, 129
Msp20I TGGCCA 1 cut(s) 53
NcoI CCATGG 1 cut(s) 48
NlaIII CATG 1 cut(s) 52
PleI GAGTC 2 cut(s) 24, 52
PpsI GAGTC 2 cut(s) 24, 52
SaqAI TTAA 2 cut(s) 78, 129
SchI GAGTC 2 cut(s) 25, 53
SetI ASST 1 cut(s) 36
SgeI CNNG 5 cut(s) 43, 50, 61, 124, 146
Sse9I AATT 1 cut(s) 66
StyI CCWWGG 2 cut(s) 30, 48
TasI AATT 1 cut(s) 66
Tru1I TTAA 2 cut(s) 78, 129
Tru9I TTAA 2 cut(s) 78, 129
TspDTI ATGAA 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.