Rh2DG357000

Pentacotripeptide-repeat region of PRORP

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0006434
Physical Location & Seq
Forward (+)
50243323 .. 50253287
9965 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG357000.1

Sequence Viewer

Length: 165 bp
ATGGCCAAAAATTGGCAGAAAGCACTGGAGCTCTATGAGGATCTTAAGTCAGCTAAAATTGAGCTGACTGTTTCAACTGTCAATGCTTTGATTACTGCCCTATGTAAGTGTCCAAATGTTACTGCCCTAACAAATGGTGTGATGACAATGCAATTCTGCTCTTGA

Protein Analysis

54

Amino Acids

5.94

Weight (kDa)

7.69

Isoelectric Point (pI)

10.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 3 - 36 1.1e-06 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 12
AclWI GGATC 1 cut(s) 48
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 12
AflII CTTAAG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 75
AluBI AGCT 3 cut(s) 31, 53, 64
AluI AGCT 3 cut(s) 31, 53, 64
Alw21I GWGCWC 1 cut(s) 33
AlwI GGATC 1 cut(s) 48
AoxI GGCC 1 cut(s) 3
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 33
Bbv12I GWGCWC 1 cut(s) 33
BfrI CTTAAG 1 cut(s) 44
BpmI CTGGAG 1 cut(s) 47
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 30
BseLI CCNNNNNNNGG 1 cut(s) 12
BseNI ACTGG 1 cut(s) 30
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 33
BslI CCNNNNNNNGG 1 cut(s) 12
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 40
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 48
BspTI CTTAAG 1 cut(s) 44
BsrI ACTGG 1 cut(s) 30
BssMI GATC 1 cut(s) 40
Bst4CI ACNGT 2 cut(s) 70, 79
BstAFI CTTAAG 1 cut(s) 44
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 23
CviJI RGCY 4 cut(s) 5, 31, 53, 64
CviKI_1 RGCY 4 cut(s) 5, 31, 53, 64
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
EaeI YGGCCR 1 cut(s) 3
Ecl136II GAGCTC 1 cut(s) 31
Eco24I GRGCYC 1 cut(s) 33
Eco53kI GAGCTC 1 cut(s) 31
EcoICRI GAGCTC 1 cut(s) 31
EcoT38I GRGCYC 1 cut(s) 33
FaiI YATR 2 cut(s) 36, 103
FriOI GRGCYC 1 cut(s) 33
FspEI CC 9 cut(s) 11, 19, 23, 112, 113, 120, 126, 139, 140
GsuI CTGGAG 1 cut(s) 47
HaeIII GGCC 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 162
HpyCH4III ACNGT 2 cut(s) 70, 79
HpyCH4V TGCA 1 cut(s) 151
Kzo9I GATC 1 cut(s) 40
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 118
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MflI RGATCY 1 cut(s) 40
MhlI GDGCHC 1 cut(s) 33
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 10, 57, 152
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 31
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 45
Msp20I TGGCCA 1 cut(s) 5
MspCI CTTAAG 1 cut(s) 44
NdeII GATC 1 cut(s) 40
PflMI CCANNNNNTGG 1 cut(s) 12
Psp124BI GAGCTC 1 cut(s) 33
PsuI RGATCY 1 cut(s) 40
SacI GAGCTC 1 cut(s) 33
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 1 cut(s) 40
SduI GDGCHC 1 cut(s) 33
SetI ASST 3 cut(s) 33, 55, 66
SgeI CNNG 1 cut(s) 38
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 3 cut(s) 10, 57, 152
SstI GAGCTC 1 cut(s) 33
TaaI ACNGT 2 cut(s) 70, 79
TasI AATT 3 cut(s) 10, 57, 152
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TscAI CASTG 1 cut(s) 30
TspRI CASTG 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 12
Vha464I CTTAAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.