Rh2DG588500

carboxylesterase 17

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
82128793 .. 82152639
23847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG588500.1

Sequence Viewer

Length: 375 bp
ATGCTAGCGAGAAAGGAATCACCAACTCATCCACCACACTCTGCACTAACTCTGTCAAACTCCGATGTGTATTGGCGACTGTCACTGCCGTTGGGGGCCAACCGAGACCATCCGTGGTGCAATCCCTTAGCAAATGGCGTGGCAAAGTTGAGGGATTTGAGACTCCCAGCTATGATGGTGTGCGTATCAGGGTTGGATATATTGAAAGACAAGAATTTGGAGCTGTGCAATGCTTTGACTAGCTTGGGGAAAAAGGTCGAAACAGTAACGTACAAAGGGGTTGGGCATGCATTTCAAGTTCTGCATAACTCTCAGCTCTCTCATCCTAGGACCCAAGAATTGGTGTCTCACATCAAGGTTTTCATAAACCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.8

Weight (kDa)

9.37

Isoelectric Point (pI)

19.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 13 - 99 2.2e-17 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 340
AcsI RAATTY 1 cut(s) 214
AfaI GTAC 1 cut(s) 272
AfiI CCNNNNNNNGG 1 cut(s) 340
AgsI TTSAA 2 cut(s) 205, 296
AluBI AGCT 4 cut(s) 170, 223, 243, 316
AluI AGCT 4 cut(s) 170, 223, 243, 316
Alw26I GTCTC 3 cut(s) 99, 154, 351
AoxI GGCC 1 cut(s) 96
ApoI RAATTY 1 cut(s) 214
AspA2I CCTAGG 1 cut(s) 326
AspS9I GGNCC 2 cut(s) 96, 330
AsuHPI GGTGA 1 cut(s) 12
AsuNHI GCTAGC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 330
AvrII CCTAGG 1 cut(s) 326
BccI CCATC 2 cut(s) 117, 169
BceAI ACGGC 1 cut(s) 73
BcoDI GTCTC 3 cut(s) 99, 154, 351
BfaI CTAG 3 cut(s) 5, 240, 327
BlnI CCTAGG 1 cut(s) 326
Bme18I GGWCC 1 cut(s) 330
BmgT120I GGNCC 2 cut(s) 96, 330
BmiI GGNNCC 2 cut(s) 97, 332
BmtI GCTAGC 1 cut(s) 8
Bpu10I CCTNAGC 1 cut(s) 127
BsaI GGTCTC 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 113, 326
Bsc4I CCNNNNNNNGG 1 cut(s) 340
Bse1I ACTGG 1 cut(s) 370
Bse3DI GCAATG 1 cut(s) 235
BseDI CCNNGG 2 cut(s) 113, 326
BseGI GGATG 3 cut(s) 28, 109, 322
BseLI CCNNNNNNNGG 1 cut(s) 340
BseMI GCAATG 1 cut(s) 235
BseMII CTCAG 1 cut(s) 326
BseNI ACTGG 1 cut(s) 370
BseYI CCCAGC 1 cut(s) 166
BsgI GTGCAG 1 cut(s) 27
BshFI GGCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 340
BsmAI GTCTC 3 cut(s) 99, 154, 351
BsnI GGCC 1 cut(s) 98
Bso31I GGTCTC 1 cut(s) 99
BspANI GGCC 1 cut(s) 98
BspCNI CTCAG 1 cut(s) 325
BspLI GGNNCC 2 cut(s) 97, 332
BspOI GCTAGC 1 cut(s) 8
BspTNI GGTCTC 1 cut(s) 99
BsrDI GCAATG 1 cut(s) 235
BsrI ACTGG 1 cut(s) 370
BssECI CCNNGG 2 cut(s) 113, 326
BssT1I CCWWGG 1 cut(s) 326
Bst4CI ACNGT 2 cut(s) 81, 265
BstC8I GCNNGC 2 cut(s) 6, 288
BstDEI CTNAG 2 cut(s) 127, 312
BstDSI CCRYGG 1 cut(s) 113
BstF5I GGATG 3 cut(s) 28, 109, 322
BstMAI GTCTC 3 cut(s) 99, 154, 351
BstNSI RCATGY 1 cut(s) 290
BsuRI GGCC 1 cut(s) 98
BtgI CCRYGG 1 cut(s) 113
BtsCI GGATG 3 cut(s) 28, 109, 322
BtsI GCAGTG 1 cut(s) 83
BtsIMutI CAGTG 1 cut(s) 83
Cac8I GCNNGC 2 cut(s) 6, 288
Cfr13I GGNCC 2 cut(s) 96, 330
Csp6I GTAC 1 cut(s) 271
CspCI CAANNNNNGTGG 2 cut(s) 120, 155
CviAII CATG 1 cut(s) 287
CviJI RGCY 5 cut(s) 98, 170, 223, 243, 316
CviKI_1 RGCY 5 cut(s) 98, 170, 223, 243, 316
CviQI GTAC 1 cut(s) 271
DdeI CTNAG 2 cut(s) 127, 312
Eco130I CCWWGG 1 cut(s) 326
Eco31I GGTCTC 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 330
EcoO109I RGGNCCY 1 cut(s) 330
EcoT14I CCWWGG 1 cut(s) 326
EcoT22I ATGCAT 1 cut(s) 292
ErhI CCWWGG 1 cut(s) 326
FaeI CATG 1 cut(s) 290
FaiI YATR 5 cut(s) 173, 200, 288, 306, 365
FatI CATG 1 cut(s) 286
FokI GGATG 3 cut(s) 15, 96, 309
FspBI CTAG 3 cut(s) 5, 240, 327
GsaI CCCAGC 1 cut(s) 170
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 1 cut(s) 290
HinfI GANTC 2 cut(s) 17, 162
HphI GGTGA 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 64
HpyCH4III ACNGT 2 cut(s) 81, 265
HpyCH4IV ACGT 1 cut(s) 269
HpyCH4V TGCA 5 cut(s) 44, 120, 228, 290, 304
HpyF3I CTNAG 2 cut(s) 127, 312
HpySE526I ACGT 1 cut(s) 269
Hsp92II CATG 1 cut(s) 290
LmnI GCTCC 1 cut(s) 220
LpnPI CCDG 2 cut(s) 174, 180
MaeI CTAG 3 cut(s) 5, 240, 327
MaeII ACGT 1 cut(s) 269
MaeIII GTNAC 2 cut(s) 81, 265
MluCI AATT 2 cut(s) 214, 338
MlyI GAGTC 1 cut(s) 156
MmeI TCCRAC 1 cut(s) 174
MnlI CCTC 1 cut(s) 144
Mph1103I ATGCAT 1 cut(s) 292
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 1 cut(s) 290
NlaIV GGNNCC 2 cut(s) 97, 332
NmuCI GTSAC 1 cut(s) 81
NsiI ATGCAT 1 cut(s) 292
NspI RCATGY 1 cut(s) 290
PaeI GCATGC 1 cut(s) 290
PfeI GAWTC 1 cut(s) 17
PflMI CCANNNNNTGG 1 cut(s) 340
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
PpuMI RGGWCCY 1 cut(s) 330
Psp5II RGGWCCY 1 cut(s) 330
PspFI CCCAGC 1 cut(s) 166
PspN4I GGNNCC 2 cut(s) 97, 332
PspPI GGNCC 2 cut(s) 96, 330
PspPPI RGGWCCY 1 cut(s) 330
RsaI GTAC 1 cut(s) 272
RsaNI GTAC 1 cut(s) 271
Sau96I GGNCC 2 cut(s) 96, 330
SchI GAGTC 1 cut(s) 156
SetI ASST 7 cut(s) 172, 225, 245, 258, 272, 318, 360
SinI GGWCC 1 cut(s) 330
SphI GCATGC 1 cut(s) 290
Sse9I AATT 2 cut(s) 214, 338
SspMI CTAG 3 cut(s) 5, 240, 327
StyI CCWWGG 1 cut(s) 326
TaaI ACNGT 2 cut(s) 81, 265
TaiI ACGT 1 cut(s) 272
TaqI TCGA 1 cut(s) 258
TasI AATT 2 cut(s) 214, 338
TfiI GAWTC 1 cut(s) 17
TscAI CASTG 1 cut(s) 90
TseFI GTSAC 1 cut(s) 81
Tsp45I GTSAC 1 cut(s) 81
TspDTI ATGAA 1 cut(s) 352
TspGWI ACGGA 1 cut(s) 102
TspRI CASTG 1 cut(s) 90
Van91I CCANNNNNTGG 1 cut(s) 340
VpaK11BI GGWCC 1 cut(s) 330
XapI RAATTY 1 cut(s) 214
XceI RCATGY 1 cut(s) 290
XmaJI CCTAGG 1 cut(s) 326
XspI CTAG 3 cut(s) 5, 240, 327
Zsp2I ATGCAT 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.