Rh3CG059100

Belongs to the small heat shock protein (HSP20) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
4084584 .. 4087809
3226 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG059100.1

Sequence Viewer

Length: 264 bp
ATGATAGTTAAGTCTGATAAGCAAGTGAAGGACAGTTGTTCCATTGAGGCTGATGGAGAAGTGAAAATTAAAGGAACAACTACAACAGGCGAGAAAACAGTGTGCAAGAACTCCATGGTCTTTCAGATGCTCTCACAGAATCTTGCCCCAGCAGGTCACTTCTCTATCTCCTTCCACCTTCCTGGCCCAGTTGATTTCCAGCAGTTCACTGGCTCTTTTGAGACTGATGGGATTCTCGAGGGCATTGTGAAGAAGAAGATATAA

Protein Analysis

87

Amino Acids

9.45

Weight (kDa)

6.71

Isoelectric Point (pI)

17.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 143
AjnI CCWGG 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 215
Ama87I CYCGRG 1 cut(s) 236
AoxI GGCC 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 185
AvaI CYCGRG 1 cut(s) 236
BccI CCATC 2 cut(s) 47, 221
BciT130I CCWGG 1 cut(s) 183
BcoDI GTCTC 1 cut(s) 215
BfuAI ACCTGC 1 cut(s) 143
Bme1390I CCNGG 1 cut(s) 183
BmeT110I CYCGRG 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 183
BmrI ACTGGG 1 cut(s) 182
BmsI GCATC 1 cut(s) 117
BmuI ACTGGG 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 188, 214
BseBI CCWGG 1 cut(s) 183
BseDI CCNNGG 1 cut(s) 114
BseNI ACTGG 2 cut(s) 188, 214
BseYI CCCAGC 1 cut(s) 148
BshFI GGCC 1 cut(s) 186
BsiHKCI CYCGRG 1 cut(s) 236
BsmAI GTCTC 1 cut(s) 215
BsnI GGCC 1 cut(s) 186
BsoBI CYCGRG 1 cut(s) 236
Bsp19I CCATGG 1 cut(s) 114
BspANI GGCC 1 cut(s) 186
BspMI ACCTGC 1 cut(s) 143
BsrI ACTGG 2 cut(s) 188, 214
BssECI CCNNGG 1 cut(s) 114
BssT1I CCWWGG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 183
Bst4CI ACNGT 2 cut(s) 35, 100
BstDSI CCRYGG 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 181
BstXI CCANNNNNNTGG 1 cut(s) 182
BsuRI GGCC 1 cut(s) 186
BtgI CCRYGG 1 cut(s) 114
BtsIMutI CAGTG 2 cut(s) 105, 207
BveI ACCTGC 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 185
CviAII CATG 1 cut(s) 115
CviJI RGCY 3 cut(s) 50, 186, 213
CviKI_1 RGCY 3 cut(s) 50, 186, 213
Eco130I CCWWGG 1 cut(s) 114
Eco88I CYCGRG 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 181
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 118
FaiI YATR 2 cut(s) 116, 262
FatI CATG 1 cut(s) 114
GsaI CCCAGC 1 cut(s) 152
HaeIII GGCC 1 cut(s) 186
Hin1II CATG 1 cut(s) 118
HinfI GANTC 2 cut(s) 139, 232
Hpy166II GTNNAC 1 cut(s) 207
Hpy188I TCNGA 2 cut(s) 16, 126
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 207
HpyAV CCTTC 3 cut(s) 22, 181, 188
HpyCH4III ACNGT 2 cut(s) 35, 100
HpyCH4V TGCA 1 cut(s) 105
Hsp92II CATG 1 cut(s) 118
LpnPI CCDG 8 cut(s) 72, 138, 162, 168, 195, 195, 201, 212
LweI GCATC 1 cut(s) 117
MaeIII GTNAC 1 cut(s) 155
MboII GAAGA 1 cut(s) 262
MluCI AATT 1 cut(s) 66
MnlI CCTC 2 cut(s) 40, 232
MseI TTAA 2 cut(s) 9, 69
MspR9I CCNGG 1 cut(s) 183
MvaI CCWGG 1 cut(s) 183
NcoI CCATGG 1 cut(s) 114
NlaIII CATG 1 cut(s) 118
NmuCI GTSAC 1 cut(s) 155
PaeR7I CTCGAG 1 cut(s) 236
PfeI GAWTC 2 cut(s) 139, 232
Psp6I CCWGG 1 cut(s) 181
PspFI CCCAGC 1 cut(s) 148
PspGI CCWGG 1 cut(s) 181
PspPI GGNCC 1 cut(s) 185
SaqAI TTAA 2 cut(s) 9, 69
Sau96I GGNCC 1 cut(s) 185
ScrFI CCNGG 1 cut(s) 183
SetI ASST 2 cut(s) 157, 180
SfaNI GCATC 1 cut(s) 117
Sfr274I CTCGAG 1 cut(s) 236
SlaI CTCGAG 1 cut(s) 236
SmlI CTYRAG 1 cut(s) 236
SmoI CTYRAG 1 cut(s) 236
Sse9I AATT 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 1 cut(s) 114
TaaI ACNGT 2 cut(s) 35, 100
TaqI TCGA 1 cut(s) 237
TasI AATT 1 cut(s) 66
TfiI GAWTC 2 cut(s) 139, 232
Tru1I TTAA 2 cut(s) 9, 69
Tru9I TTAA 2 cut(s) 9, 69
TscAI CASTG 2 cut(s) 105, 214
TseFI GTSAC 1 cut(s) 155
Tsp45I GTSAC 1 cut(s) 155
TspRI CASTG 2 cut(s) 105, 214
XcmI CCANNNNNNNNNTGG 1 cut(s) 206
XhoI CTCGAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.